ID: 907646575

View in Genome Browser
Species Human (GRCh38)
Location 1:56250542-56250564
Sequence CTAACTGATTTTGAAATTTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907646569_907646575 24 Left 907646569 1:56250495-56250517 CCATTACTCACCTTAAGTTCATA No data
Right 907646575 1:56250542-56250564 CTAACTGATTTTGAAATTTCTGG No data
907646572_907646575 0 Left 907646572 1:56250519-56250541 CCTTTCATCTGAAAAATGGCCTC No data
Right 907646575 1:56250542-56250564 CTAACTGATTTTGAAATTTCTGG No data
907646570_907646575 14 Left 907646570 1:56250505-56250527 CCTTAAGTTCATAACCTTTCATC No data
Right 907646575 1:56250542-56250564 CTAACTGATTTTGAAATTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907646575 Original CRISPR CTAACTGATTTTGAAATTTC TGG Intergenic
No off target data available for this crispr