ID: 907646615

View in Genome Browser
Species Human (GRCh38)
Location 1:56250947-56250969
Sequence GGGAGTAGAAGCAGAAAGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907646615_907646623 27 Left 907646615 1:56250947-56250969 CCTCCCTTTCTGCTTCTACTCCC No data
Right 907646623 1:56250997-56251019 CATGATTCTGCTTAACATCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907646615 Original CRISPR GGGAGTAGAAGCAGAAAGGG AGG (reversed) Intergenic
No off target data available for this crispr