ID: 907647426

View in Genome Browser
Species Human (GRCh38)
Location 1:56258297-56258319
Sequence CACTACTGCTGGAGCAACAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907647426_907647433 15 Left 907647426 1:56258297-56258319 CCAATGTTGCTCCAGCAGTAGTG No data
Right 907647433 1:56258335-56258357 ATGGGGAAAGCAGTTAGGAAAGG No data
907647426_907647429 -3 Left 907647426 1:56258297-56258319 CCAATGTTGCTCCAGCAGTAGTG No data
Right 907647429 1:56258317-56258339 GTGTATGACCAAAATGAAATGGG No data
907647426_907647428 -4 Left 907647426 1:56258297-56258319 CCAATGTTGCTCCAGCAGTAGTG No data
Right 907647428 1:56258316-56258338 AGTGTATGACCAAAATGAAATGG No data
907647426_907647434 16 Left 907647426 1:56258297-56258319 CCAATGTTGCTCCAGCAGTAGTG No data
Right 907647434 1:56258336-56258358 TGGGGAAAGCAGTTAGGAAAGGG No data
907647426_907647432 10 Left 907647426 1:56258297-56258319 CCAATGTTGCTCCAGCAGTAGTG No data
Right 907647432 1:56258330-56258352 ATGAAATGGGGAAAGCAGTTAGG No data
907647426_907647430 -2 Left 907647426 1:56258297-56258319 CCAATGTTGCTCCAGCAGTAGTG No data
Right 907647430 1:56258318-56258340 TGTATGACCAAAATGAAATGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907647426 Original CRISPR CACTACTGCTGGAGCAACAT TGG (reversed) Intergenic
No off target data available for this crispr