ID: 907647429 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:56258317-56258339 |
Sequence | GTGTATGACCAAAATGAAAT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | No |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
907647426_907647429 | -3 | Left | 907647426 | 1:56258297-56258319 | CCAATGTTGCTCCAGCAGTAGTG | No data | ||
Right | 907647429 | 1:56258317-56258339 | GTGTATGACCAAAATGAAATGGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
907647429 | Original CRISPR | GTGTATGACCAAAATGAAAT GGG | Intergenic | ||
No off target data available for this crispr |