ID: 907647429

View in Genome Browser
Species Human (GRCh38)
Location 1:56258317-56258339
Sequence GTGTATGACCAAAATGAAAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907647426_907647429 -3 Left 907647426 1:56258297-56258319 CCAATGTTGCTCCAGCAGTAGTG No data
Right 907647429 1:56258317-56258339 GTGTATGACCAAAATGAAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907647429 Original CRISPR GTGTATGACCAAAATGAAAT GGG Intergenic
No off target data available for this crispr