ID: 907648074

View in Genome Browser
Species Human (GRCh38)
Location 1:56264237-56264259
Sequence TAACTCAGACCACTTTTAGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907648074_907648078 9 Left 907648074 1:56264237-56264259 CCCTCTAAAAGTGGTCTGAGTTA No data
Right 907648078 1:56264269-56264291 GTGCTGCTAATTCATTTTGTAGG No data
907648074_907648079 20 Left 907648074 1:56264237-56264259 CCCTCTAAAAGTGGTCTGAGTTA No data
Right 907648079 1:56264280-56264302 TCATTTTGTAGGTTCAAGCCAGG No data
907648074_907648080 25 Left 907648074 1:56264237-56264259 CCCTCTAAAAGTGGTCTGAGTTA No data
Right 907648080 1:56264285-56264307 TTGTAGGTTCAAGCCAGGCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907648074 Original CRISPR TAACTCAGACCACTTTTAGA GGG (reversed) Intergenic
No off target data available for this crispr