ID: 907648078

View in Genome Browser
Species Human (GRCh38)
Location 1:56264269-56264291
Sequence GTGCTGCTAATTCATTTTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907648075_907648078 8 Left 907648075 1:56264238-56264260 CCTCTAAAAGTGGTCTGAGTTAG No data
Right 907648078 1:56264269-56264291 GTGCTGCTAATTCATTTTGTAGG No data
907648074_907648078 9 Left 907648074 1:56264237-56264259 CCCTCTAAAAGTGGTCTGAGTTA No data
Right 907648078 1:56264269-56264291 GTGCTGCTAATTCATTTTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907648078 Original CRISPR GTGCTGCTAATTCATTTTGT AGG Intergenic
No off target data available for this crispr