ID: 907649600

View in Genome Browser
Species Human (GRCh38)
Location 1:56282404-56282426
Sequence AGTTGTGATGGCAGTAGAGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907649600_907649607 30 Left 907649600 1:56282404-56282426 CCACCTCTACTGCCATCACAACT No data
Right 907649607 1:56282457-56282479 CAATGCCACCATGTTAGAAACGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907649600 Original CRISPR AGTTGTGATGGCAGTAGAGG TGG (reversed) Intergenic
No off target data available for this crispr