ID: 907651207

View in Genome Browser
Species Human (GRCh38)
Location 1:56296424-56296446
Sequence ATTGAGGCTCAGATTGAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907651207_907651211 13 Left 907651207 1:56296424-56296446 CCTTCCTCAATCTGAGCCTCAAT No data
Right 907651211 1:56296460-56296482 TAGTGTCCCTTCTAGCTCTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907651207 Original CRISPR ATTGAGGCTCAGATTGAGGA AGG (reversed) Intergenic
No off target data available for this crispr