ID: 907654663

View in Genome Browser
Species Human (GRCh38)
Location 1:56330084-56330106
Sequence CAGGGCCACATGATGATTAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907654663_907654671 27 Left 907654663 1:56330084-56330106 CCACTAATCATCATGTGGCCCTG No data
Right 907654671 1:56330134-56330156 CAGTTTCCTTGTATATAAAGTGG No data
907654663_907654668 2 Left 907654663 1:56330084-56330106 CCACTAATCATCATGTGGCCCTG No data
Right 907654668 1:56330109-56330131 CAAGTCCCTTGATCTGTACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907654663 Original CRISPR CAGGGCCACATGATGATTAG TGG (reversed) Intergenic
No off target data available for this crispr