ID: 907659218

View in Genome Browser
Species Human (GRCh38)
Location 1:56376686-56376708
Sequence CTGTTCCTGCAGATGCAGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907659214_907659218 13 Left 907659214 1:56376650-56376672 CCTGTTTTCCTTCCAGCGTGCAT No data
Right 907659218 1:56376686-56376708 CTGTTCCTGCAGATGCAGAGAGG No data
907659216_907659218 1 Left 907659216 1:56376662-56376684 CCAGCGTGCATACTGCTGCCACG No data
Right 907659218 1:56376686-56376708 CTGTTCCTGCAGATGCAGAGAGG No data
907659215_907659218 5 Left 907659215 1:56376658-56376680 CCTTCCAGCGTGCATACTGCTGC No data
Right 907659218 1:56376686-56376708 CTGTTCCTGCAGATGCAGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907659218 Original CRISPR CTGTTCCTGCAGATGCAGAG AGG Intergenic
No off target data available for this crispr