ID: 907661047

View in Genome Browser
Species Human (GRCh38)
Location 1:56392711-56392733
Sequence CTTTTTATTCTGAAGGAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907661047_907661051 15 Left 907661047 1:56392711-56392733 CCCACTTCCTTCAGAATAAAAAG No data
Right 907661051 1:56392749-56392771 CCAGACCATTCTTCTTGTGAAGG No data
907661047_907661056 25 Left 907661047 1:56392711-56392733 CCCACTTCCTTCAGAATAAAAAG No data
Right 907661056 1:56392759-56392781 CTTCTTGTGAAGGAATGGGAGGG No data
907661047_907661055 24 Left 907661047 1:56392711-56392733 CCCACTTCCTTCAGAATAAAAAG No data
Right 907661055 1:56392758-56392780 TCTTCTTGTGAAGGAATGGGAGG No data
907661047_907661053 20 Left 907661047 1:56392711-56392733 CCCACTTCCTTCAGAATAAAAAG No data
Right 907661053 1:56392754-56392776 CCATTCTTCTTGTGAAGGAATGG No data
907661047_907661054 21 Left 907661047 1:56392711-56392733 CCCACTTCCTTCAGAATAAAAAG No data
Right 907661054 1:56392755-56392777 CATTCTTCTTGTGAAGGAATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907661047 Original CRISPR CTTTTTATTCTGAAGGAAGT GGG (reversed) Intergenic
No off target data available for this crispr