ID: 907661150

View in Genome Browser
Species Human (GRCh38)
Location 1:56393529-56393551
Sequence CTTTCCTCACCTATAGAACA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907661147_907661150 0 Left 907661147 1:56393506-56393528 CCATGTTAGCCCTCTGAGCATCA No data
Right 907661150 1:56393529-56393551 CTTTCCTCACCTATAGAACAAGG No data
907661146_907661150 23 Left 907661146 1:56393483-56393505 CCTCGCTGAGTTATTTAAGCAAA No data
Right 907661150 1:56393529-56393551 CTTTCCTCACCTATAGAACAAGG No data
907661145_907661150 27 Left 907661145 1:56393479-56393501 CCTTCCTCGCTGAGTTATTTAAG No data
Right 907661150 1:56393529-56393551 CTTTCCTCACCTATAGAACAAGG No data
907661149_907661150 -10 Left 907661149 1:56393516-56393538 CCTCTGAGCATCACTTTCCTCAC No data
Right 907661150 1:56393529-56393551 CTTTCCTCACCTATAGAACAAGG No data
907661148_907661150 -9 Left 907661148 1:56393515-56393537 CCCTCTGAGCATCACTTTCCTCA No data
Right 907661150 1:56393529-56393551 CTTTCCTCACCTATAGAACAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907661150 Original CRISPR CTTTCCTCACCTATAGAACA AGG Intergenic
No off target data available for this crispr