ID: 907661785

View in Genome Browser
Species Human (GRCh38)
Location 1:56400004-56400026
Sequence CAGGCTTTTCCCTTGCAGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907661785_907661788 -7 Left 907661785 1:56400004-56400026 CCACCCTGCAAGGGAAAAGCCTG No data
Right 907661788 1:56400020-56400042 AAGCCTGAAGTTGCTAAAGAAGG No data
907661785_907661789 -6 Left 907661785 1:56400004-56400026 CCACCCTGCAAGGGAAAAGCCTG No data
Right 907661789 1:56400021-56400043 AGCCTGAAGTTGCTAAAGAAGGG No data
907661785_907661792 21 Left 907661785 1:56400004-56400026 CCACCCTGCAAGGGAAAAGCCTG No data
Right 907661792 1:56400048-56400070 AACTGAACTTGAGGCAGATCCGG No data
907661785_907661791 12 Left 907661785 1:56400004-56400026 CCACCCTGCAAGGGAAAAGCCTG No data
Right 907661791 1:56400039-56400061 AAGGGTTGAAACTGAACTTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907661785 Original CRISPR CAGGCTTTTCCCTTGCAGGG TGG (reversed) Intergenic
No off target data available for this crispr