ID: 907663482

View in Genome Browser
Species Human (GRCh38)
Location 1:56414583-56414605
Sequence CACACACACATCCCTAGCTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 16 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907663475_907663482 7 Left 907663475 1:56414553-56414575 CCTGCCCCCCACCACACACACAC 0: 4
1: 61
2: 419
3: 1530
4: 4652
Right 907663482 1:56414583-56414605 CACACACACATCCCTAGCTTAGG No data
907663480_907663482 -1 Left 907663480 1:56414561-56414583 CCACCACACACACACACACACAC 0: 536
1: 4846
2: 6904
3: 10649
4: 17543
Right 907663482 1:56414583-56414605 CACACACACATCCCTAGCTTAGG No data
907663474_907663482 8 Left 907663474 1:56414552-56414574 CCCTGCCCCCCACCACACACACA No data
Right 907663482 1:56414583-56414605 CACACACACATCCCTAGCTTAGG No data
907663469_907663482 15 Left 907663469 1:56414545-56414567 CCCCCCACCCTGCCCCCCACCAC No data
Right 907663482 1:56414583-56414605 CACACACACATCCCTAGCTTAGG No data
907663477_907663482 2 Left 907663477 1:56414558-56414580 CCCCCACCACACACACACACACA 0: 173
1: 951
2: 2620
3: 10483
4: 17126
Right 907663482 1:56414583-56414605 CACACACACATCCCTAGCTTAGG No data
907663470_907663482 14 Left 907663470 1:56414546-56414568 CCCCCACCCTGCCCCCCACCACA No data
Right 907663482 1:56414583-56414605 CACACACACATCCCTAGCTTAGG No data
907663473_907663482 11 Left 907663473 1:56414549-56414571 CCACCCTGCCCCCCACCACACAC No data
Right 907663482 1:56414583-56414605 CACACACACATCCCTAGCTTAGG No data
907663467_907663482 22 Left 907663467 1:56414538-56414560 CCACCAGCCCCCCACCCTGCCCC No data
Right 907663482 1:56414583-56414605 CACACACACATCCCTAGCTTAGG No data
907663481_907663482 -4 Left 907663481 1:56414564-56414586 CCACACACACACACACACACACA 0: 3779
1: 5173
2: 8013
3: 13571
4: 22268
Right 907663482 1:56414583-56414605 CACACACACATCCCTAGCTTAGG No data
907663466_907663482 23 Left 907663466 1:56414537-56414559 CCCACCAGCCCCCCACCCTGCCC No data
Right 907663482 1:56414583-56414605 CACACACACATCCCTAGCTTAGG No data
907663468_907663482 19 Left 907663468 1:56414541-56414563 CCAGCCCCCCACCCTGCCCCCCA No data
Right 907663482 1:56414583-56414605 CACACACACATCCCTAGCTTAGG No data
907663471_907663482 13 Left 907663471 1:56414547-56414569 CCCCACCCTGCCCCCCACCACAC No data
Right 907663482 1:56414583-56414605 CACACACACATCCCTAGCTTAGG No data
907663478_907663482 1 Left 907663478 1:56414559-56414581 CCCCACCACACACACACACACAC 0: 226
1: 1272
2: 3988
3: 10746
4: 14599
Right 907663482 1:56414583-56414605 CACACACACATCCCTAGCTTAGG No data
907663479_907663482 0 Left 907663479 1:56414560-56414582 CCCACCACACACACACACACACA 0: 237
1: 1875
2: 8746
3: 10115
4: 16197
Right 907663482 1:56414583-56414605 CACACACACATCCCTAGCTTAGG No data
907663476_907663482 3 Left 907663476 1:56414557-56414579 CCCCCCACCACACACACACACAC 0: 80
1: 562
2: 1907
3: 5474
4: 15506
Right 907663482 1:56414583-56414605 CACACACACATCCCTAGCTTAGG No data
907663472_907663482 12 Left 907663472 1:56414548-56414570 CCCACCCTGCCCCCCACCACACA No data
Right 907663482 1:56414583-56414605 CACACACACATCCCTAGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907663482 Original CRISPR CACACACACATCCCTAGCTT AGG Intergenic
No off target data available for this crispr