ID: 907665925

View in Genome Browser
Species Human (GRCh38)
Location 1:56433836-56433858
Sequence TAAGGTTGTATCTCTACTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907665925_907665927 -5 Left 907665925 1:56433836-56433858 CCATGAGTAGAGATACAACCTTA No data
Right 907665927 1:56433854-56433876 CCTTATTGCTGTAGAAGTACAGG No data
907665925_907665931 30 Left 907665925 1:56433836-56433858 CCATGAGTAGAGATACAACCTTA No data
Right 907665931 1:56433889-56433911 AACTTCATTTAGGAGTATCAAGG No data
907665925_907665928 -4 Left 907665925 1:56433836-56433858 CCATGAGTAGAGATACAACCTTA No data
Right 907665928 1:56433855-56433877 CTTATTGCTGTAGAAGTACAGGG No data
907665925_907665929 0 Left 907665925 1:56433836-56433858 CCATGAGTAGAGATACAACCTTA No data
Right 907665929 1:56433859-56433881 TTGCTGTAGAAGTACAGGGAAGG No data
907665925_907665930 20 Left 907665925 1:56433836-56433858 CCATGAGTAGAGATACAACCTTA No data
Right 907665930 1:56433879-56433901 AGGAAGCTAAAACTTCATTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907665925 Original CRISPR TAAGGTTGTATCTCTACTCA TGG (reversed) Intergenic
No off target data available for this crispr