ID: 907665926

View in Genome Browser
Species Human (GRCh38)
Location 1:56433854-56433876
Sequence CCTGTACTTCTACAGCAATA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907665926_907665931 12 Left 907665926 1:56433854-56433876 CCTTATTGCTGTAGAAGTACAGG No data
Right 907665931 1:56433889-56433911 AACTTCATTTAGGAGTATCAAGG No data
907665926_907665934 30 Left 907665926 1:56433854-56433876 CCTTATTGCTGTAGAAGTACAGG No data
Right 907665934 1:56433907-56433929 CAAGGAAGGCTTCTCAGAGGAGG No data
907665926_907665930 2 Left 907665926 1:56433854-56433876 CCTTATTGCTGTAGAAGTACAGG No data
Right 907665930 1:56433879-56433901 AGGAAGCTAAAACTTCATTTAGG No data
907665926_907665932 16 Left 907665926 1:56433854-56433876 CCTTATTGCTGTAGAAGTACAGG No data
Right 907665932 1:56433893-56433915 TCATTTAGGAGTATCAAGGAAGG No data
907665926_907665933 27 Left 907665926 1:56433854-56433876 CCTTATTGCTGTAGAAGTACAGG No data
Right 907665933 1:56433904-56433926 TATCAAGGAAGGCTTCTCAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907665926 Original CRISPR CCTGTACTTCTACAGCAATA AGG (reversed) Intergenic
No off target data available for this crispr