ID: 907665931

View in Genome Browser
Species Human (GRCh38)
Location 1:56433889-56433911
Sequence AACTTCATTTAGGAGTATCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907665926_907665931 12 Left 907665926 1:56433854-56433876 CCTTATTGCTGTAGAAGTACAGG No data
Right 907665931 1:56433889-56433911 AACTTCATTTAGGAGTATCAAGG No data
907665925_907665931 30 Left 907665925 1:56433836-56433858 CCATGAGTAGAGATACAACCTTA No data
Right 907665931 1:56433889-56433911 AACTTCATTTAGGAGTATCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907665931 Original CRISPR AACTTCATTTAGGAGTATCA AGG Intergenic
No off target data available for this crispr