ID: 907667208

View in Genome Browser
Species Human (GRCh38)
Location 1:56443837-56443859
Sequence GCTGCTTCCTGCCCTGCTTT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907667201_907667208 29 Left 907667201 1:56443785-56443807 CCACTAAGTGCTTCTGTTGGGGA No data
Right 907667208 1:56443837-56443859 GCTGCTTCCTGCCCTGCTTTAGG No data
907667202_907667208 -6 Left 907667202 1:56443820-56443842 CCCATCTGTCCCTCCCAGCTGCT No data
Right 907667208 1:56443837-56443859 GCTGCTTCCTGCCCTGCTTTAGG No data
907667203_907667208 -7 Left 907667203 1:56443821-56443843 CCATCTGTCCCTCCCAGCTGCTT No data
Right 907667208 1:56443837-56443859 GCTGCTTCCTGCCCTGCTTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907667208 Original CRISPR GCTGCTTCCTGCCCTGCTTT AGG Intergenic
No off target data available for this crispr