ID: 907671978

View in Genome Browser
Species Human (GRCh38)
Location 1:56483443-56483465
Sequence CTCTCTTTCAGCTTGATTCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907671978_907671982 28 Left 907671978 1:56483443-56483465 CCATGAATCAAGCTGAAAGAGAG No data
Right 907671982 1:56483494-56483516 CACACATGCCAGAGAATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907671978 Original CRISPR CTCTCTTTCAGCTTGATTCA TGG (reversed) Intergenic
No off target data available for this crispr