ID: 907675282

View in Genome Browser
Species Human (GRCh38)
Location 1:56512141-56512163
Sequence CTGCAGGTATAGCTGGAGAA AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 301
Summary {0: 1, 1: 1, 2: 1, 3: 30, 4: 268}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907675277_907675282 -3 Left 907675277 1:56512121-56512143 CCTCGCCAAGTGAAGCGGGCCTG 0: 1
1: 0
2: 1
3: 6
4: 65
Right 907675282 1:56512141-56512163 CTGCAGGTATAGCTGGAGAAAGG 0: 1
1: 1
2: 1
3: 30
4: 268
907675279_907675282 -8 Left 907675279 1:56512126-56512148 CCAAGTGAAGCGGGCCTGCAGGT 0: 1
1: 0
2: 1
3: 8
4: 91
Right 907675282 1:56512141-56512163 CTGCAGGTATAGCTGGAGAAAGG 0: 1
1: 1
2: 1
3: 30
4: 268
907675274_907675282 13 Left 907675274 1:56512105-56512127 CCGGAGCAGGCGGGCTCCTCGCC 0: 1
1: 0
2: 0
3: 10
4: 151
Right 907675282 1:56512141-56512163 CTGCAGGTATAGCTGGAGAAAGG 0: 1
1: 1
2: 1
3: 30
4: 268

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907675282 Original CRISPR CTGCAGGTATAGCTGGAGAA AGG Exonic
901416575 1:9120642-9120664 CTGCAGCTTTAACTGCAGAAGGG + Intronic
902526772 1:17063979-17064001 CTGCATGTCCAGCTGGAGAAGGG + Intergenic
902777288 1:18682919-18682941 GTGCAGGGACAGGTGGAGAAGGG - Intronic
904205116 1:28849283-28849305 CTGTTGGCAGAGCTGGAGAAAGG - Intronic
904367541 1:30024432-30024454 ATGAAGCTATTGCTGGAGAATGG + Intergenic
904824847 1:33267420-33267442 CTGCATGTATAGATGGAGCAAGG - Intronic
904922549 1:34020342-34020364 CTGCAAATATAGCTGGATAAAGG + Intronic
905112240 1:35604240-35604262 CTTTGGGTATAGATGGAGAATGG - Intronic
906730827 1:48079708-48079730 CTGAAAGGATAGCAGGAGAAAGG - Intergenic
907675282 1:56512141-56512163 CTGCAGGTATAGCTGGAGAAAGG + Exonic
908789420 1:67766889-67766911 ATGCAGGTCTAGCTACAGAAGGG + Intronic
908797159 1:67841974-67841996 CTGCAGGTAGAGTTGGAGCCAGG - Intergenic
910199021 1:84678626-84678648 TGGCAGGTAGAGGTGGAGAAAGG + Intronic
911140884 1:94501341-94501363 CTGCATATATAACTGGAGCATGG + Intronic
911272394 1:95818589-95818611 CTGCAAGTAGAGATGGAGAATGG - Intergenic
912252459 1:108025722-108025744 CTGCAGCCACAGCTGGAGCAAGG - Intergenic
915694099 1:157721757-157721779 CTGCAGATTTACCTGGAGCATGG + Intergenic
916477818 1:165186513-165186535 CTGCAGGAATAGCCGTGGAAGGG - Intergenic
916714055 1:167435081-167435103 CTGGAGGTAGGGCTGGAGGAGGG - Intronic
916850737 1:168700768-168700790 CTGCAGTTTTGGCTGGAAAATGG - Intronic
918871563 1:189981732-189981754 CTCCAGGTATACCTGGAGTTGGG + Intergenic
919772743 1:201173099-201173121 GTGCAGCTCTTGCTGGAGAAGGG + Intergenic
919925185 1:202188500-202188522 CTCCAGGTGTTGCTGGACAATGG + Intergenic
920095511 1:203483912-203483934 GTCCAGGTAGAGCTGGTGAATGG - Exonic
922209508 1:223476768-223476790 CACAAGGTATAGCTGGAGAGGGG - Intergenic
923488066 1:234455327-234455349 CTGCAGGTACATCTGCAGAATGG - Intronic
924145918 1:241074487-241074509 CTTCAGGTACAGCTGGAGCCAGG + Intronic
1065100692 10:22329107-22329129 CTACATTTATACCTGGAGAAGGG + Exonic
1065928331 10:30456354-30456376 CTGCAGGGAAAGCTTGAGAACGG + Intronic
1066217850 10:33305400-33305422 CTGAAGGTCTAGCTGCAAAATGG + Intronic
1067249196 10:44573083-44573105 CTGCAGGCATAGCTGGATCCAGG - Intergenic
1067546798 10:47197605-47197627 CTGCAGGTATAGCGGTTGGAGGG - Intergenic
1070347161 10:75555749-75555771 CTGCAGGAATACCTGGATGATGG + Intronic
1073603888 10:104873882-104873904 CTGCAAGTAGTGCTGGAGAGAGG - Intronic
1074902251 10:117828481-117828503 CTACAGGTAAAGTTGGAAAATGG - Intergenic
1075579659 10:123607492-123607514 CTGTAGGTATACCTGGGGGATGG + Intergenic
1077866907 11:6230004-6230026 CTGAAGGTAAATCTGGAGAGTGG - Intronic
1078338678 11:10483714-10483736 ATGCAGGCAGAGCTGGAGAGGGG - Intronic
1078538552 11:12194904-12194926 CTGCCTGTATAACTGCAGAAAGG - Intronic
1079016201 11:16870804-16870826 CAGAAGATATAGCAGGAGAAAGG + Intronic
1079134250 11:17767502-17767524 CTCCAGGGCTGGCTGGAGAAAGG - Intronic
1079858805 11:25641714-25641736 CTCCTGTTAAAGCTGGAGAATGG - Intergenic
1080640851 11:34157508-34157530 CTACAGGGATCGCTGGAGACTGG - Intronic
1080738165 11:35037722-35037744 CTGCAGGTATACATGGAAATAGG + Intergenic
1082780213 11:57281583-57281605 CTGCTTGTATAACTGCAGAATGG - Intergenic
1083953155 11:65967744-65967766 CTGCAGAAGCAGCTGGAGAAGGG + Exonic
1084084624 11:66849354-66849376 CTGCAGGTGGAGCTGGAGCGGGG - Exonic
1084382004 11:68818517-68818539 CTGAAGTTATAGCTGGTGGAAGG - Intronic
1085024083 11:73226512-73226534 CTGCAGGAATAGCTTGGGTACGG - Intronic
1087549686 11:99633293-99633315 ATGCAGGCATAGCAGGAGCAAGG - Intronic
1088890007 11:114036706-114036728 CTGCTGTTTTTGCTGGAGAAGGG + Intergenic
1089048968 11:115529290-115529312 CTGCAAGTATGTCTGGAAAATGG + Intergenic
1089323364 11:117641291-117641313 CTGCAGGCATTGCTGGGGAGGGG + Intronic
1090284936 11:125491662-125491684 TTGTAGGTAGAGATGGAGAATGG - Intronic
1091801628 12:3328201-3328223 CTGCAGGTAGAGCAGGAGCTGGG - Intergenic
1091986542 12:4914161-4914183 GTGCAGGTATAGGCGGAGAGAGG + Exonic
1092247014 12:6869385-6869407 TCGCAGGTATCTCTGGAGAAAGG + Exonic
1092252208 12:6905822-6905844 CTGCAGGTAGAAGTGGAGTAAGG - Intronic
1092800213 12:12157344-12157366 ATGCAGGTAGACCTGGACAATGG - Intronic
1093281112 12:17197426-17197448 CTGCAGGTACCACTGAAGAATGG - Intergenic
1095166079 12:38973644-38973666 CTGGAGGAATTGCTGGAGAGAGG - Intergenic
1095710120 12:45279210-45279232 CTGAAGGTAGGGCAGGAGAATGG - Intronic
1096139852 12:49233980-49234002 CCGCAGCCATAGGTGGAGAAAGG + Intronic
1097022128 12:56027884-56027906 CGGCAGGCATAGTTGCAGAAGGG - Exonic
1098215063 12:68207138-68207160 CTGCTGGTGTAGCTGTAGCAGGG + Intronic
1100042446 12:90336682-90336704 ATGAAGGTGTAGCTGCAGAAAGG - Intergenic
1100785532 12:98074022-98074044 CTGCAGGGAGAGATGGTGAAGGG - Intergenic
1102002459 12:109565957-109565979 CTGCAGGGATTCCTGGAGGAGGG + Intronic
1102250707 12:111385522-111385544 CAGCAGAAAGAGCTGGAGAAAGG + Intergenic
1103139901 12:118539517-118539539 CTTCAGGTATAGCTGGATGCAGG + Intergenic
1104276632 12:127334521-127334543 GTGCAGCTAGAGCTGGAGCAGGG - Intergenic
1104359623 12:128120607-128120629 CTGCAGGTAGGGCTGGGAAAAGG - Intergenic
1104595076 12:130115345-130115367 CTGCAGGTCTAGCTGGAGGCAGG + Intergenic
1104628026 12:130375839-130375861 CAGCAGGTCTGGCTGGAGGATGG - Intergenic
1110284805 13:73737243-73737265 CTACAGTTGTAGCTGAAGAAAGG - Intronic
1114268138 14:21084742-21084764 CTTCAGATCTATCTGGAGAAAGG - Exonic
1114350237 14:21842533-21842555 CTGCAGCTAAGGCTGGAGATGGG - Intergenic
1115074935 14:29377097-29377119 CAGTATGTGTAGCTGGAGAAAGG - Intergenic
1115874901 14:37849951-37849973 CTGCAGGCATACATGGAAAAAGG - Intronic
1118740777 14:68737877-68737899 CTGCAGAAATAGCTAGAGATTGG - Intergenic
1119860402 14:77931823-77931845 CTGCAGGGATATCTGGAGATTGG - Intronic
1120723852 14:87916470-87916492 ATGGAGGTACAGCGGGAGAAAGG + Intronic
1122464501 14:101921757-101921779 TTGAAGGAATAGCTGGAGAGTGG + Intronic
1124876485 15:33599760-33599782 CTTCAGGTAAAACTGGGGAATGG - Intronic
1127396049 15:58544718-58544740 CTGTGGGTAGGGCTGGAGAACGG + Intronic
1127547156 15:60002364-60002386 CTGGGGGTATGGCTCGAGAAGGG - Intergenic
1127605574 15:60583980-60584002 GTGCAGGTGTTGCTGGAGAAAGG + Intronic
1127675262 15:61232132-61232154 CTGCATGGATGGCTGCAGAAAGG - Intergenic
1128529636 15:68435546-68435568 CTGCAGGTGTGGCTGGATCAAGG + Intergenic
1129599944 15:76992934-76992956 CTCGAGGTAGAACTGGAGAAAGG + Intergenic
1129696860 15:77745579-77745601 CTGCAGGTTTCACTGAAGAAAGG - Intronic
1130276063 15:82476929-82476951 CTGCAGGTTCACCTGGAGGAAGG + Intergenic
1130468423 15:84204320-84204342 CTGCAGGTTCACCTGGAGGAAGG + Intergenic
1130485323 15:84395430-84395452 CTGCAGGTTCACCTGGAGGAAGG - Intergenic
1130495843 15:84469222-84469244 CTGCAGGTTCACCTGGAGGAAGG - Intergenic
1131073007 15:89477642-89477664 CTCCAGGAATGGCTGGAGACGGG + Exonic
1131667351 15:94584797-94584819 TTGCTGAAATAGCTGGAGAATGG - Intergenic
1133338537 16:5022049-5022071 CTTCAGGTATAGCTGGATCCAGG + Intergenic
1133492898 16:6288713-6288735 CTGCTGGTACAGCTGAAGCAAGG + Intronic
1133657029 16:7875439-7875461 CTGCAGGAAGACATGGAGAAGGG + Intergenic
1133723788 16:8519021-8519043 CTGCAGAAATAGCTTGAGGAAGG - Intergenic
1133863567 16:9619845-9619867 CTGAAGGAAGAGCTGGAGCATGG - Intergenic
1134518763 16:14908062-14908084 CTGGAGGCAGAGCTGGAGACAGG - Intronic
1134706434 16:16306715-16306737 CTGGAGGCAGAGCTGGAGACAGG - Intergenic
1134961106 16:18405395-18405417 CTGGAGGCAGAGCTGGAGACAGG + Intergenic
1134965408 16:18487998-18488020 CTGGAGGCAGAGCTGGAGACAGG + Intronic
1136683338 16:31980485-31980507 CTGCAGCTGCTGCTGGAGAATGG + Intergenic
1136720182 16:32313842-32313864 CTTCAGGCATAGCTGGATACAGG + Intergenic
1136725235 16:32352236-32352258 CTTCAGGCATAGCTGGATACAGG + Intergenic
1136783968 16:32924041-32924063 CTGCAGCTGCTGCTGGAGAATGG + Intergenic
1136838558 16:33520118-33520140 CTTCAGGCATAGCTGGATACAGG + Intergenic
1136843562 16:33558292-33558314 CTTCAGGCATAGCTGGATACAGG + Intergenic
1136885814 16:33929765-33929787 CTGCAGCTGCTGCTGGAGAATGG - Intergenic
1137556412 16:49473181-49473203 CACCAGGGATGGCTGGAGAAGGG - Intergenic
1137840854 16:51639690-51639712 CTTCAGGTATTGCTGGATCAAGG + Intergenic
1138309351 16:56009929-56009951 CTGAAGTTGGAGCTGGAGAAGGG + Intergenic
1139530809 16:67541879-67541901 CGGCAGGAGGAGCTGGAGAATGG + Exonic
1141440540 16:84026867-84026889 CTGCGGGCAGAGGTGGAGAATGG + Intronic
1141455093 16:84136060-84136082 CTGCAGGTGGAGCTGAAGAAGGG - Intronic
1141623548 16:85249682-85249704 CTGCGGGGACAGCTGGACAACGG - Intergenic
1203001195 16_KI270728v1_random:165518-165540 CTTCAGGCATAGCTGGATACAGG - Intergenic
1203006249 16_KI270728v1_random:203927-203949 CTTCAGGCATAGCTGGATACAGG - Intergenic
1203086624 16_KI270728v1_random:1188043-1188065 CTGCAGCTGCTGCTGGAGAATGG + Intergenic
1203132798 16_KI270728v1_random:1701922-1701944 CTTCAGGCATAGCTGGATACAGG - Intergenic
1203148722 16_KI270728v1_random:1820404-1820426 CTTCAGGCATAGCTGGATACAGG + Intergenic
1203153727 16_KI270728v1_random:1858590-1858612 CTTCAGGCATAGCTGGATACAGG + Intergenic
1142797670 17:2321376-2321398 CTGCAGTGATAGCTGGACAAGGG + Exonic
1143284912 17:5781744-5781766 CTGCAGGTACAGGTGGAGGATGG + Intronic
1143284935 17:5781868-5781890 ATGCAGGTACAGGTGGAGGATGG + Intronic
1143284952 17:5781958-5781980 ATGCAGGTACAGGTGGAGGATGG + Intronic
1147043244 17:37733953-37733975 CTGCATGTGGAGCTGGAGATGGG + Intronic
1147144250 17:38476196-38476218 CTGCAGCTGCTGCTGGAGAATGG + Intronic
1148119117 17:45197445-45197467 CTCAGGGTAGAGCTGGAGAAGGG - Intergenic
1148757956 17:49984433-49984455 CTGGAGGATTAGCTGGAGCAGGG - Intergenic
1148797206 17:50202737-50202759 GTCCAGGTACAACTGGAGAAGGG - Intergenic
1149581413 17:57752940-57752962 ATGCAGGTACAGCTTGAGACTGG - Intergenic
1150301684 17:64052666-64052688 GTGCCCGTGTAGCTGGAGAATGG - Intronic
1150470915 17:65436920-65436942 CTGCAGCTGTAGTTGGAGAGAGG - Intergenic
1151375742 17:73687665-73687687 CTGCAGGTCTTGATGGAGAGAGG - Intergenic
1152741894 17:82022080-82022102 CTTCAGGTAGAGCAGTAGAAAGG + Intronic
1152930394 17:83106380-83106402 ATTCAGATATAGCTGGAGGATGG + Intergenic
1154197657 18:12278401-12278423 CTGCAGGCACAGCTGGACGAAGG + Intergenic
1155724569 18:29063758-29063780 ATGCAGACATAGATGGAGAAGGG - Intergenic
1157287707 18:46388474-46388496 CTGCACGTTTAGCAGGAGATCGG + Intronic
1159818153 18:73103428-73103450 CTGCAGGAATTGTTGGACAATGG - Intergenic
1162023973 19:7883263-7883285 CTGCAGGTATAGATGCTGAGTGG - Intergenic
1163654835 19:18539612-18539634 CTGCAGACGTCGCTGGAGAATGG - Exonic
1164916251 19:32054469-32054491 CTTCAGGTATAGCTGGATCCAGG - Intergenic
1165334695 19:35161296-35161318 CTTCAGGCATAGCTGGATCAAGG + Intronic
1166147616 19:40848380-40848402 CTGCGGGTATGGCGGGAGAAGGG + Intronic
1166178409 19:41090381-41090403 CTGCAGGTGTGGCGGGAGAAGGG - Intronic
926844911 2:17125677-17125699 CTTTAGGTATAGCTGGAAGAAGG - Intergenic
927633791 2:24796799-24796821 CTGCAGGTGAAGGTGGATAAGGG + Intronic
928429179 2:31203776-31203798 CTGCAGGTATCGATGGTGATGGG + Intronic
931132823 2:59357195-59357217 CTACAGGCATAGATTGAGAATGG + Intergenic
934320643 2:91968324-91968346 CTTCAGGCATAGCTGGATACAGG - Intergenic
934761873 2:96861038-96861060 CTGCGGGAAGAGCTGGAGAAAGG - Exonic
935286240 2:101566093-101566115 CTGCTGAGATAGCTGGAGGAAGG - Intergenic
936663088 2:114563977-114563999 CCGCTGGGATAGCAGGAGAATGG + Intronic
937753914 2:125513275-125513297 CTACAATTTTAGCTGGAGAAAGG + Intergenic
941115426 2:161466822-161466844 CTTCAGATAGAGCTGGAGAAAGG - Intronic
941312700 2:163953652-163953674 CTACAGGTATAGATAGATAAGGG - Intergenic
942334069 2:174862167-174862189 CTGCAGGATCAGCTGTAGAAAGG + Intronic
944291889 2:198017389-198017411 CTGCAGATTTAACTGGACAAAGG - Intronic
946059597 2:216930364-216930386 CTTCAGGTATAGCTGGACCCAGG + Intergenic
946219174 2:218211631-218211653 CTGGAGGACTAACTGGAGAATGG + Intergenic
946804041 2:223452042-223452064 CTGCAGGCAGAGCTGGCGCAGGG + Intergenic
946830670 2:223725280-223725302 CTGCAGATAAAGCTTCAGAAAGG + Intergenic
948826240 2:240574607-240574629 CTGCAGGTCAAGCTGGAGCCAGG + Exonic
1170571562 20:17635633-17635655 CTTCAGGAGCAGCTGGAGAATGG - Exonic
1171188852 20:23144074-23144096 CTGCAGGGCTGGCTGAAGAATGG + Intergenic
1171487955 20:25497427-25497449 CTGCAGATAGAACTGGAGAAAGG - Intronic
1172692867 20:36802702-36802724 CTTCAGGTATAGCTGGATCCAGG - Intronic
1172692875 20:36802757-36802779 CTTCAGGTATAGCTGGATCTAGG - Intronic
1173270332 20:41528290-41528312 TGGCTGGTATAGCTGGAGGAGGG - Intronic
1173945742 20:46949505-46949527 GTTCAGGTATAGCTGGATCAGGG + Intronic
1174187165 20:48714715-48714737 CTTCAGGTATGGCTGGATCATGG - Intronic
1175052009 20:56164400-56164422 CTTCAGGTATAGCTGGATGCAGG - Intergenic
1175728951 20:61339769-61339791 CTGCAGGCATCGCTGGGGATTGG + Intronic
1177168962 21:17634505-17634527 TTGCAGATGTAGCTAGAGAAAGG + Intergenic
1179359265 21:40690098-40690120 CAGGAGGTTTAGGTGGAGAAGGG - Intronic
1180308892 22:11152383-11152405 CTTCAGGCATAGCTGGATACAGG - Intergenic
1180547369 22:16514194-16514216 CTTCAGGCATAGCTGGATACAGG - Intergenic
1182211795 22:28683140-28683162 CTTCAGGCATAGCTGGATACAGG + Intergenic
1182529605 22:30945047-30945069 CTGCAGGGCCACCTGGAGAAAGG - Intronic
1183026927 22:35072172-35072194 CTACAGGGATACCTGGAGACTGG + Intronic
1183561976 22:38582227-38582249 CAGGAGGGATAGCTGGAGAGGGG - Exonic
1184643557 22:45884554-45884576 CTGCAGGGACAGCTTGGGAAGGG + Intergenic
1184895328 22:47403311-47403333 CACCAGGTATGGCAGGAGAATGG + Intergenic
1185267568 22:49912281-49912303 CTGCAGCTTCAGCTGGTGAACGG - Intronic
1203281567 22_KI270734v1_random:134464-134486 CTGCAGGCACAGCTGGAGCCAGG + Intergenic
950665897 3:14494826-14494848 CTGCAGGTAATGCTGGGGCAGGG - Exonic
952271959 3:31841701-31841723 GTGCAGGCATAACTAGAGAAAGG - Intronic
954217437 3:49132474-49132496 CTGCAGGTGTGGCTGGGGACAGG - Exonic
956283970 3:67589360-67589382 CTGGAGATATAACTGGAGTAAGG - Intronic
956722885 3:72133818-72133840 CTTCAGGTATAGCTGGATCCAGG + Intergenic
958699173 3:97566688-97566710 CTGCAGGTATGGCTGGATCTAGG + Intronic
959014897 3:101122681-101122703 CTCATGGTATAGTTGGAGAAGGG + Intergenic
959940399 3:112075305-112075327 CTGCAGGCTTTGGTGGAGAAAGG - Exonic
965872472 3:173278427-173278449 TTGTAGGTATAGAGGGAGAAAGG - Intergenic
968069112 3:195774996-195775018 CTTCAAGTTTATCTGGAGAAAGG - Intronic
968646162 4:1741629-1741651 CTGCAGGTGCAGCTGGAAGAGGG + Intronic
969315375 4:6378573-6378595 CTGCAGGGAAACCCGGAGAAGGG + Intronic
970451473 4:16170519-16170541 TTGGAGGTATAGCTGTTGAATGG + Intronic
970740959 4:19237107-19237129 CTTCAGTTGTTGCTGGAGAAGGG - Intergenic
973929956 4:55782117-55782139 ATGCAGGGATAGCAGGAGAAAGG - Intergenic
974242575 4:59269316-59269338 CTGCTGGTATAGCTGCAGCATGG + Intergenic
974625056 4:64415557-64415579 CTGCACTTATATTTGGAGAATGG + Intergenic
974810845 4:66944043-66944065 TTGCAGGTATGGCTAAAGAAGGG + Intergenic
976176493 4:82358694-82358716 CTTCAGGTGTATCTGGAGAAAGG + Exonic
978349176 4:107803369-107803391 CTGGAAGTAGAGCAGGAGAAGGG + Intergenic
979506273 4:121501417-121501439 ATGCAGGGATAGCAGGAGAAAGG + Intergenic
979863759 4:125726891-125726913 CTGCTGGCATAGTTGTAGAAAGG + Intergenic
982116465 4:152102596-152102618 CTTCAGCTACAGCTGGAGCAGGG - Intergenic
982586735 4:157250911-157250933 AAGCAAGCATAGCTGGAGAATGG - Intronic
987007308 5:13723869-13723891 CTTCACTTATATCTGGAGAAGGG + Intronic
989461271 5:41701416-41701438 CTGAATGTGAAGCTGGAGAAAGG - Intergenic
990999203 5:61766090-61766112 CTGCAGGTATGGCTGGATTTGGG - Intergenic
991581333 5:68158161-68158183 CTGCTGATATAGTTGGAAAATGG + Intergenic
991997316 5:72400790-72400812 CTGCAGGAATAACTGGGGGAAGG - Intergenic
992229330 5:74648459-74648481 CTGCAGATTGTGCTGGAGAAGGG - Intronic
993327977 5:86565891-86565913 TTCCAGGTATGACTGGAGAAGGG + Intergenic
994211082 5:97088093-97088115 CTCCAGGTATATCTGGATCAAGG - Intergenic
995891887 5:116963217-116963239 CAGCAGTCACAGCTGGAGAAGGG - Intergenic
996012257 5:118493985-118494007 CTGTAGGCAGAGCTGGACAATGG - Intergenic
996458785 5:123716855-123716877 CTGCAGGGATAGCCAGTGAATGG + Intergenic
997214647 5:132100761-132100783 ATGCAGGTGCAGCTGGAGGAAGG - Intergenic
998278958 5:140786513-140786535 CTGGAGGTAAATCTGCAGAATGG + Exonic
998279793 5:140795187-140795209 CTGGAGGTAAATCTGCAGAATGG + Exonic
998280374 5:140801420-140801442 CTGGAGGTAAATCTGCAGAATGG + Exonic
998280984 5:140807410-140807432 CTGGAGGTAAATCTGCAGAATGG + Exonic
998282137 5:140821995-140822017 CTGGAGGTAAATCTGCAGAATGG + Exonic
998282760 5:140828314-140828336 CTGGAGGTAAATCTGCAGAATGG + Exonic
998283354 5:140834606-140834628 CTGGAGGTAAATCTGCAGAATGG + Exonic
998284721 5:140848718-140848740 CTGGAGGTAAATCTGCAGAATGG + Exonic
998285452 5:140856268-140856290 CTGGAGGTAAATCTGCAGAATGG + Exonic
998285995 5:140861453-140861475 CTGGAGGTAAATCTGCAGAATGG + Intronic
998286665 5:140869326-140869348 CTGGAGGTAAATCTGCAGAATGG + Exonic
998287304 5:140875695-140875717 CTGGAGGTAAATCTGCAGAATGG + Exonic
998287964 5:140882491-140882513 CTGGAGGTAAATCTGCAGAATGG + Exonic
999115315 5:149157800-149157822 CTTCAGGTATGGCTGGATTAGGG - Intronic
999685384 5:154098152-154098174 CTTCAGGTATGGCTGGATAGAGG + Intronic
1002077372 5:176716823-176716845 CTGCAGGTACACCTGGAAATGGG - Intergenic
1006026204 6:31148660-31148682 CTGCAGGGATCGCTGCAGGATGG + Exonic
1007821364 6:44562800-44562822 CTGCAAGTCCAGGTGGAGAATGG - Intergenic
1009705564 6:67246285-67246307 CAGCATGGATAGCTGGACAAAGG - Intergenic
1013086207 6:106859872-106859894 CTGCAGCTGGAGCTGGGGAAAGG + Intergenic
1013421084 6:109967588-109967610 TTGAAGGTTTGGCTGGAGAAAGG - Intergenic
1014493393 6:122090239-122090261 CTGTAAGTAGAGCTGGAGAAAGG + Intergenic
1014561633 6:122898337-122898359 CTGGAGGTAAAGCATGAGAAAGG - Intergenic
1016404647 6:143717213-143717235 CAATAGGTATAGCTGGAGGAAGG - Intronic
1017969049 6:159294705-159294727 CAGAAGAAATAGCTGGAGAAGGG + Intergenic
1018572305 6:165224470-165224492 CTGCAGATATAGCTGGAGAAGGG - Intergenic
1018812107 6:167305846-167305868 CTGCAGCTTTAGCTTGAGCACGG + Intronic
1022493664 7:30839681-30839703 TTGCAGATAGAGCTGGAGAAAGG + Intronic
1028033456 7:85949321-85949343 CTGCAGGTGTATCTGCACAAGGG + Intergenic
1029578094 7:101417280-101417302 CTGGAGGTATGGATGAAGAATGG + Intronic
1029796224 7:102897248-102897270 GAGTAGGTATAGCTGGAGAAGGG + Intronic
1031905627 7:127457422-127457444 CTGCAGCTTGAGGTGGAGAAGGG - Intergenic
1032017108 7:128387356-128387378 CTGCAGGAGTGGCTGGAGAGAGG - Intergenic
1032119655 7:129146562-129146584 CTGCTGCTATAGCTGGGGTATGG + Intronic
1032349731 7:131149601-131149623 CTTCAGGTTTAGTTGAAGAATGG - Intronic
1033337134 7:140463444-140463466 TTGCAGGTATAGCTAGAGGAAGG - Intronic
1033448051 7:141439073-141439095 CTGCAGGTCAAGCTGGGGACAGG + Intronic
1034073043 7:148206532-148206554 CTGCAGGTGCTGCTGAAGAAAGG - Intronic
1034872755 7:154698269-154698291 CAGCTGGTCTAGCTGGAAAATGG - Intronic
1036258259 8:7221807-7221829 CTGCGGCTGTAGCTGGAGAGGGG - Intergenic
1036484089 8:9164069-9164091 CTACAGCTCTGGCTGGAGAAGGG + Intronic
1037323324 8:17664506-17664528 CTGCAGGCAGAGCTGGAGGCAGG - Intronic
1037985899 8:23290329-23290351 CTGCAGCTAGACCTGGAAAAGGG + Exonic
1040499223 8:47992526-47992548 GTGCAGGAATAGATGGGGAATGG + Intergenic
1040825146 8:51612299-51612321 CAGCAGATATAGGAGGAGAAAGG + Intronic
1045219384 8:100182540-100182562 GGGCAGGGAGAGCTGGAGAAAGG + Intronic
1045444179 8:102242945-102242967 ATGCAGTTATAGCTGGAGTCAGG - Intergenic
1046383569 8:113480542-113480564 CTTCAGGTAACACTGGAGAATGG + Intergenic
1046480994 8:114818317-114818339 CTGCAGCTGAAGCAGGAGAATGG + Intergenic
1048919311 8:139213448-139213470 CTGCAGGTGCTGCTGCAGAAGGG - Intergenic
1050043725 9:1521842-1521864 CTCCAGGTATTGCTGTAGAAAGG + Intergenic
1051072597 9:13190151-13190173 CAGCACATAGAGCTGGAGAAAGG - Exonic
1051676018 9:19558936-19558958 TTGCAGGGATGGTTGGAGAAGGG + Intronic
1052038912 9:23715596-23715618 CTGAAGCCATTGCTGGAGAATGG - Intronic
1052415593 9:28172638-28172660 CTTCAGGGAAAGATGGAGAAAGG + Intronic
1052738870 9:32374385-32374407 CTGTAGGTCTCACTGGAGAATGG + Intergenic
1055284432 9:74713189-74713211 CTGAAGGTATGTCTGGAAAAAGG - Intergenic
1056208829 9:84345663-84345685 TGGCAGGTACAGTTGGAGAATGG - Intergenic
1056946853 9:91005026-91005048 CTGCAGGGATAGGTGGAGCTCGG - Intergenic
1057313841 9:93956920-93956942 CAGCAGCTGGAGCTGGAGAAAGG - Intergenic
1057496485 9:95565184-95565206 CTGCAGGTGGACTTGGAGAAAGG - Intergenic
1059235312 9:112755723-112755745 CTTCAGGGATGGCTGGAGCAAGG + Intronic
1061759930 9:132843557-132843579 GTGCAGGTTGACCTGGAGAAAGG + Intronic
1185645140 X:1610532-1610554 CTGGAGGTTTGGCTGGAGCAGGG - Intergenic
1186524741 X:10238212-10238234 CTGGGGGTACAGCTGGGGAAAGG + Intergenic
1187018801 X:15358177-15358199 CTGCAGTTATAGATGAAGAATGG - Exonic
1187474960 X:19602396-19602418 CTGTAAGTACAGCTGGAGAAGGG + Intronic
1189277521 X:39797546-39797568 CTGCAGGTCTGGCTGGAGAAAGG + Intergenic
1189424101 X:40882610-40882632 CTTCAGGTACAGATGGGGAAAGG + Intergenic
1191701248 X:64044779-64044801 CTTCAGGTGTATCTGGAGAAAGG - Intergenic
1193640217 X:84003226-84003248 GTGCAAGTATAGGTGGAGGAGGG - Intergenic
1195998884 X:110760046-110760068 ATGCAGCTAGAGCTGGGGAATGG - Intronic
1197422024 X:126249541-126249563 CTACAGGTAAAGCTGGACAAAGG + Intergenic
1197727798 X:129787964-129787986 CTGAAGGGAGAGCTGGAAAAAGG - Exonic