ID: 907675779

View in Genome Browser
Species Human (GRCh38)
Location 1:56516594-56516616
Sequence TCATCTGCATGAAGGCCTCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 1, 3: 18, 4: 157}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907675774_907675779 25 Left 907675774 1:56516546-56516568 CCTCTTCTAGTCTACTGCTGACA 0: 1
1: 0
2: 3
3: 13
4: 138
Right 907675779 1:56516594-56516616 TCATCTGCATGAAGGCCTCTGGG 0: 1
1: 0
2: 1
3: 18
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907675779 Original CRISPR TCATCTGCATGAAGGCCTCT GGG Intronic