ID: 907678805

View in Genome Browser
Species Human (GRCh38)
Location 1:56544207-56544229
Sequence GGGCTGAAACAGCTGGAGCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 288
Summary {0: 1, 1: 0, 2: 3, 3: 20, 4: 264}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907678805_907678811 -2 Left 907678805 1:56544207-56544229 CCCAGCTCCAGCTGTTTCAGCCC 0: 1
1: 0
2: 3
3: 20
4: 264
Right 907678811 1:56544228-56544250 CCTTTCTGTTGGATTTTTAAAGG 0: 1
1: 0
2: 3
3: 33
4: 420
907678805_907678812 -1 Left 907678805 1:56544207-56544229 CCCAGCTCCAGCTGTTTCAGCCC 0: 1
1: 0
2: 3
3: 20
4: 264
Right 907678812 1:56544229-56544251 CTTTCTGTTGGATTTTTAAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907678805 Original CRISPR GGGCTGAAACAGCTGGAGCT GGG (reversed) Intronic
900935570 1:5764296-5764318 GGGCTTAAGCAGCTGGAGGGTGG - Intergenic
901089940 1:6634510-6634532 TGGCTGAGACAGCTGGCGCGGGG - Exonic
902186048 1:14726242-14726264 GGGCACAGACAGCTGGTGCTTGG + Intronic
902220412 1:14960986-14961008 GGGCAGCCACAGCTGGAGGTGGG - Intronic
903025051 1:20422260-20422282 TGGGTGAAATATCTGGAGCTAGG - Intergenic
903134913 1:21302994-21303016 GGGCAGAAATAGCAGGAGCCTGG - Intronic
903263717 1:22144108-22144130 GGGCTGCAACAGCCTGTGCTTGG + Intergenic
904756610 1:32771702-32771724 GGGCGGAACTAGCAGGAGCTGGG - Exonic
904826170 1:33275385-33275407 GGGCTGAAGAGGCTGAAGCTAGG - Intronic
906200756 1:43958706-43958728 GGGCTGGGAGATCTGGAGCTTGG + Intronic
907528483 1:55069578-55069600 GGGCTGATCTAGTTGGAGCTGGG + Intronic
907678805 1:56544207-56544229 GGGCTGAAACAGCTGGAGCTGGG - Intronic
909297885 1:73974201-73974223 GGGCTGTGTCATCTGGAGCTTGG - Intergenic
909301127 1:74014686-74014708 GACCTGAAAAATCTGGAGCTTGG + Intergenic
910452721 1:87363376-87363398 AGGATGCAACAGCTGGTGCTAGG - Intergenic
910560331 1:88582786-88582808 GTGCTGAGTCACCTGGAGCTGGG - Intergenic
910639652 1:89446215-89446237 GTGCTGAGCCACCTGGAGCTAGG + Intergenic
911581922 1:99644115-99644137 AGGCAGAAAAGGCTGGAGCTGGG - Intergenic
915543302 1:156582264-156582286 CAGCGGGAACAGCTGGAGCTGGG - Exonic
915912382 1:159923089-159923111 GGGCTGCGGCTGCTGGAGCTGGG + Intronic
917069641 1:171136223-171136245 GAGCTGAAAGAGCAGGAACTAGG - Intergenic
917848878 1:179043198-179043220 GGGCTGAGACAGCAGGGGCCTGG + Intronic
920053650 1:203177953-203177975 AATCTGAACCAGCTGGAGCTGGG - Intergenic
920255896 1:204654081-204654103 GGGGTCAAACAGCTGAAGCTGGG + Intronic
921924912 1:220703408-220703430 GGGCTGAAGAGGATGGAGCTGGG + Intergenic
922320373 1:224481619-224481641 GTGCTGAGATACCTGGAGCTGGG + Intronic
924833757 1:247627947-247627969 ACTCTGAACCAGCTGGAGCTAGG + Intergenic
1063505407 10:6593627-6593649 GGGCTGATGCAGCTGGAGCTGGG - Intergenic
1065777695 10:29136874-29136896 GGGCTGAAACAGCTGAAGGCTGG + Intergenic
1067435308 10:46272712-46272734 GGGCTGCCACATCTTGAGCTAGG - Intergenic
1067563693 10:47321800-47321822 GGCCTGATTGAGCTGGAGCTGGG - Intergenic
1067758530 10:49025553-49025575 GGGCTGCAACAGATCTAGCTGGG + Intronic
1076029093 10:127142517-127142539 AGTCTGAAGCAGCTGGAGCCAGG + Intronic
1076142933 10:128093944-128093966 TGGCTAAAACAGGTGGTGCTGGG - Intergenic
1076470906 10:130717394-130717416 GGGCTGAAATAGCCAGAGATGGG + Intergenic
1077048487 11:556256-556278 GTGCTGAAGCAGCTGGTGCGCGG - Exonic
1077420304 11:2446837-2446859 TGGCTGCAACAGCGGGGGCTCGG + Intronic
1078243446 11:9551480-9551502 GGGCAGAAACAGTTACAGCTTGG + Intergenic
1078255346 11:9653930-9653952 TGGCTGAAACAGCTGGGGGTTGG + Intergenic
1078377667 11:10809274-10809296 GGGATGATACAACTGGAGCATGG - Intergenic
1080419796 11:32099669-32099691 GGATTGAAACAGTTGGAACTGGG - Intronic
1081671837 11:44946860-44946882 GGGATGAGGCAGCTTGAGCTGGG - Intronic
1083604784 11:63971750-63971772 GGGCTGACACAGGTGTTGCTGGG + Intergenic
1083662278 11:64256947-64256969 GGGCTGGAACAGCTTGTGTTAGG + Intronic
1083816447 11:65134859-65134881 GGGCTGTACCACCTGGAGCGGGG + Intergenic
1084273636 11:68041303-68041325 GGGCAGAAAGAGCTGGACCAGGG - Exonic
1084365140 11:68692860-68692882 GGGCTGGAGCTGGTGGAGCTGGG + Intergenic
1084869343 11:72086427-72086449 GGACTGAAACAGCTGAACCTGGG + Intronic
1084934141 11:72578115-72578137 GGGATGAATCAGTTGGACCTGGG + Intronic
1086249643 11:84798040-84798062 GCGCTGAGCCACCTGGAGCTGGG + Intronic
1088750584 11:112839068-112839090 GGACTGAAGCAGCCTGAGCTTGG - Intergenic
1088938106 11:114425313-114425335 GTGCTGAGCCACCTGGAGCTGGG + Intronic
1089002860 11:115066900-115066922 ATGCTGCAACAGCTGGAGCCAGG + Intergenic
1089210029 11:116793756-116793778 GAGGTGAAGCAGCTGGAACTTGG - Intergenic
1089629388 11:119774617-119774639 GGGCTGAAATGGCTGGTCCTGGG + Intergenic
1091369346 11:135045708-135045730 GAGCTGAAATAGCTGGAGGCTGG - Intergenic
1092173059 12:6385172-6385194 GGGCTGGATCCCCTGGAGCTTGG + Intronic
1093490584 12:19700350-19700372 GGGCTGAAGGAGGAGGAGCTGGG + Intronic
1096691917 12:53326660-53326682 GGGTTAAAGCCGCTGGAGCTTGG - Exonic
1097867282 12:64569314-64569336 GGGCTGTGTCAGCTGGAGCAGGG - Intergenic
1103452236 12:121037346-121037368 GGCATGAAACAGCTGGAGGAAGG + Intronic
1104084192 12:125459176-125459198 GGGCTGAAACTGGGGCAGCTGGG + Intronic
1104286321 12:127428065-127428087 GGGCTGAAACGGGAGCAGCTGGG - Intergenic
1105881123 13:24607254-24607276 GGGCTGTGGCAGCTGGTGCTGGG + Intergenic
1106571538 13:30932667-30932689 GCGCTGAGATAGCTGGAGCCAGG + Intergenic
1107171026 13:37342028-37342050 GGGCTGAAAGAGCTGTACCCAGG + Intergenic
1109922792 13:69091040-69091062 GGACTGAAACAGATGGAATTAGG - Intergenic
1109988065 13:70016573-70016595 GGGCTGAAACAGAAGGAGGCTGG - Intronic
1110168687 13:72474300-72474322 GAACTAAAACAGCTGGTGCTAGG + Intergenic
1113660273 13:112103018-112103040 GGGGTGAAACAGCAGGAGGAAGG + Intergenic
1116206611 14:41875312-41875334 GTGCTGGAACAGCAGGAGTTTGG - Intronic
1117164852 14:53023019-53023041 GAGCTGAGGCAGCTGGTGCTTGG + Intergenic
1118648753 14:67867745-67867767 GTCCAGAAACAGCTGGGGCTGGG - Intronic
1119558717 14:75572937-75572959 CCAGTGAAACAGCTGGAGCTCGG + Intergenic
1119694903 14:76705423-76705445 GTGCTGAGACAGCAGGAGCAGGG - Intergenic
1120222742 14:81753147-81753169 GGGCTGGGACAGCGGGAGATGGG - Intergenic
1123150238 14:106174616-106174638 AGGCTGCAACAGCTGAACCTGGG + Intergenic
1123396833 15:19944672-19944694 GGGCAAAATCAGCGGGAGCTGGG - Intergenic
1125983378 15:44025021-44025043 AGGCTGAAAGAGCTTGAGCTAGG - Intronic
1127155635 15:56122399-56122421 AGGCTGAAATGCCTGGAGCTGGG + Intronic
1128340789 15:66821320-66821342 GGGCTGGGACAGCTGGAGGAAGG + Intergenic
1129446838 15:75625074-75625096 GGGTTGAAACAGCAGGAGCCCGG - Intronic
1135076931 16:19401907-19401929 GGACTGAAACAGGTGGAAGTGGG + Intergenic
1135329037 16:21545887-21545909 GGGCTGGTCCAGATGGAGCTGGG - Intergenic
1135547690 16:23376985-23377007 GGGGTGAAATGGCTGGAGGTCGG + Intronic
1136339383 16:29631864-29631886 GGGCTGGTCCAGATGGAGCTGGG - Intergenic
1136511488 16:30740477-30740499 GGGATGGAGCAACTGGAGCTAGG - Exonic
1136679813 16:31952172-31952194 AGGCTGCAACAGCTGAACCTGGG - Intergenic
1136890248 16:33965929-33965951 AGGCTGCAACAGCTGAACCTGGG + Intergenic
1137779742 16:51087925-51087947 GGGCTCAGCCAGCTGGATCTGGG + Intergenic
1139463370 16:67140705-67140727 GGGCAAAGACAGCTGGGGCTAGG - Intronic
1141701004 16:85642021-85642043 AGGCTGGAACAGCTGGAGGGAGG - Intronic
1203082783 16_KI270728v1_random:1157685-1157707 AGGCTGCAACAGCTGAACCTGGG - Intergenic
1142715070 17:1742818-1742840 GGGCTGGGCCAGCTGGAGCCTGG + Exonic
1143039430 17:4022615-4022637 GGGCAGAAGCAGCTGGAACTCGG + Intronic
1143338000 17:6187962-6187984 AGGCTGAATGAGCTGGAGGTGGG - Intergenic
1143659564 17:8316157-8316179 GGGCAGAAACGGCCGCAGCTGGG - Intronic
1143845369 17:9769476-9769498 GGACAGAAGCAGCTGGAGCCAGG - Intergenic
1144733366 17:17541318-17541340 GAGCTGAAAGAGCTGGGGCTCGG - Intronic
1145165808 17:20612748-20612770 GGGCCGAGACAGCATGAGCTGGG + Intergenic
1146058994 17:29594659-29594681 GGGCTGCAAGAGCCAGAGCTGGG + Intronic
1149180539 17:53931563-53931585 GTGCTGAGCCACCTGGAGCTGGG + Intergenic
1149640599 17:58200058-58200080 GACATGAAGCAGCTGGAGCTGGG - Intronic
1150003920 17:61457903-61457925 GGGCCAAAAGTGCTGGAGCTGGG - Intronic
1150220283 17:63492117-63492139 TGGCTGGAACGGCTGGAGGTGGG + Intronic
1151243756 17:72778596-72778618 GGCCTGAGACATCTTGAGCTAGG + Intronic
1151747167 17:76017894-76017916 GGTCTGAGCCAGATGGAGCTGGG + Exonic
1152190877 17:78886526-78886548 GTGCAGAAACAGCAGGAGCACGG + Intronic
1152239284 17:79153120-79153142 GGGCAGACACAGCTGGACCAGGG - Intronic
1152559089 17:81068921-81068943 AGCCTGGAGCAGCTGGAGCTCGG - Intronic
1153227752 18:2910870-2910892 AGGCTGATTAAGCTGGAGCTTGG + Intronic
1153429597 18:5000845-5000867 GTGCTGAGATACCTGGAGCTGGG - Intergenic
1159826530 18:73219533-73219555 GGGCTAAAAGAGCTGGAACAGGG - Intronic
1162721307 19:12664568-12664590 GGGCGGAGCCAGCCGGAGCTGGG + Intronic
1163653320 19:18531646-18531668 TGGTTGAGCCAGCTGGAGCTGGG - Intergenic
1166209606 19:41297705-41297727 GGGCTCTAACAGCTAGAGCCAGG + Intronic
1166736855 19:45090998-45091020 GGGCTGAATCCAGTGGAGCTGGG + Exonic
1166906705 19:46115487-46115509 AGGCAGAAACAGCTACAGCTTGG + Intergenic
1166915990 19:46196429-46196451 GGACTGAAACAGCTGTGGATGGG - Intergenic
1167697796 19:51025347-51025369 GGGCTGAGGAAGCTGGAGTTGGG - Intronic
925293776 2:2764926-2764948 GGGCTGAACCATCTGGGGGTGGG + Intergenic
926714652 2:15914594-15914616 GGGCTGAGAGCTCTGGAGCTGGG + Intergenic
927570163 2:24152644-24152666 GTGCTGAGCCACCTGGAGCTGGG + Intronic
929000393 2:37342743-37342765 GGCCTCCAACAGCTGGAGCAGGG - Intergenic
929334265 2:40721738-40721760 GGTCTGAACCAGCTGAAACTTGG - Intergenic
929600173 2:43199775-43199797 GGGCTGGAGAAGCAGGAGCTGGG + Intergenic
930030572 2:47055989-47056011 GGGAAGAAAAAGCTGGAGCCAGG - Intronic
931367970 2:61635960-61635982 GGGCAGAAAAAGCTTGAGATGGG - Intergenic
931666755 2:64615281-64615303 AGGCTGAAGGAGGTGGAGCTGGG + Intergenic
932482434 2:72053688-72053710 GGGCTGAAACAGCTTGGGATTGG - Intergenic
932642167 2:73460196-73460218 GGGTTGAAAGAGTTGGGGCTGGG - Intronic
935203995 2:100881981-100882003 ATGCTGAAACTGCTGGGGCTGGG + Intronic
936558210 2:113514267-113514289 GAGCTGAAGCAGCTGCAGCAGGG + Intergenic
936940279 2:117877846-117877868 GTGCTGAACTACCTGGAGCTAGG + Intergenic
937231496 2:120400669-120400691 GGGCAGAATTAGCGGGAGCTGGG - Intergenic
937271406 2:120655139-120655161 GCCCTGAAAAAGCTGGAGCAAGG - Intergenic
939273706 2:139971753-139971775 GTGCTGAACCACCTGGAACTGGG - Intergenic
940243103 2:151584640-151584662 TGGCTTAAAGAGTTGGAGCTGGG + Intronic
940244058 2:151595192-151595214 TGGCTTAAAGAGTTGGAGCTGGG + Intronic
940245016 2:151605744-151605766 TGGCTTAAAGAGTTGGAGCTGGG + Intronic
943913210 2:193594073-193594095 GTGCTGAGACACCTGGAGCTGGG - Intergenic
945210346 2:207375861-207375883 GTGCTGAGCCACCTGGAGCTGGG - Intergenic
947687036 2:232097282-232097304 GTGCTGAGCCACCTGGAGCTGGG + Intronic
1170402499 20:16003519-16003541 GGGCTACACCTGCTGGAGCTAGG - Intronic
1171777829 20:29387373-29387395 GTGCTGAGACATATGGAGCTGGG + Intergenic
1174611754 20:51802756-51802778 GGACTGAGATAGCTGGAGCAAGG - Intergenic
1175441662 20:58996502-58996524 TGGCTGAGACAGCTGGAGCAAGG + Intronic
1175741106 20:61420288-61420310 GGGCTGAAAGAACTGGAGGAGGG + Intronic
1176039289 20:63055957-63055979 GAGCAGGAGCAGCTGGAGCTTGG + Intergenic
1178842303 21:36147452-36147474 GTGCTGACACTGCTGGTGCTGGG + Intergenic
1180061014 21:45385113-45385135 GAGCTGGAGCTGCTGGAGCTGGG - Intergenic
1180674298 22:17576726-17576748 GGGCTGGAACTGCAGCAGCTTGG + Intronic
1180900512 22:19368847-19368869 AGGGTGGAGCAGCTGGAGCTCGG - Intronic
1181717053 22:24738525-24738547 GTGCTGAACCGCCTGGAGCTGGG - Intronic
1182008091 22:26978207-26978229 GGCCTCAAACAGCTGAAACTGGG - Intergenic
1182225943 22:28798962-28798984 GGGCTGAAACAACTTGGGATGGG + Intronic
1182549426 22:31092972-31092994 TGTCTAAAACAGCTGGAGTTAGG + Intronic
1182698423 22:32211812-32211834 GGGCTGAAACTCCTGGAGTCAGG + Intergenic
1183292706 22:37012548-37012570 GGGCTCAAAGAGATGGAGATAGG - Intronic
1185234746 22:49705297-49705319 GGGCCGCCACAGCTGGAGCTGGG - Intergenic
1185306706 22:50121682-50121704 TGGCAGAAAAAGCTGGACCTGGG + Intronic
950695518 3:14698639-14698661 GTGCTGAGCCACCTGGAGCTGGG + Intronic
951182028 3:19669659-19669681 GTGCTGAACCACGTGGAGCTGGG - Intergenic
951402939 3:22257088-22257110 AGGCTGAAACAACAGGACCTTGG + Intronic
951557888 3:23938968-23938990 GAGCTGAAACAGCAGGGGGTTGG - Intronic
953359169 3:42280053-42280075 GAGCTGGAACAGCAGCAGCTGGG - Intergenic
953982509 3:47419745-47419767 GGGCTGAAGCTGCTGGGGGTTGG - Intronic
954372402 3:50175693-50175715 GGGCTGGGAGAGCTGGGGCTGGG + Intronic
954442393 3:50528834-50528856 GAGGTCACACAGCTGGAGCTTGG - Intergenic
956244895 3:67171916-67171938 GGGCTGAAGCAGCTGGGGGCTGG + Intergenic
957890079 3:86345603-86345625 ATGCTGAACCACCTGGAGCTGGG + Intergenic
958728272 3:97932597-97932619 GGGCTGAAGCAACTGCAACTCGG - Intronic
960148111 3:114224936-114224958 GGGCTGGAAGAGCTGGCTCTAGG + Intergenic
960320740 3:116232614-116232636 AGGCTGAACTAGCTGGAGGTAGG - Intronic
960725120 3:120662352-120662374 GGTCTGAACCAGGTGGAGGTAGG + Intronic
961449602 3:126996570-126996592 GTCCTGAAAGAGCTGGAGCTGGG + Intronic
961797249 3:129418383-129418405 GGGCTCGGGCAGCTGGAGCTGGG + Exonic
963138429 3:141928761-141928783 GGGACGAAACAGCCAGAGCTGGG + Intergenic
968657467 4:1784913-1784935 GGTGTGAAACCGCTGGGGCTGGG - Intergenic
968746546 4:2363383-2363405 GGACTGTAACAGCTTGAGTTAGG + Intronic
969332878 4:6490107-6490129 GGGCTGAACCAGCTGGTGGGAGG - Intronic
969622718 4:8286804-8286826 GGGCGGAAGCACCTGGGGCTGGG + Intronic
969656021 4:8499037-8499059 GGGCAGATACAGCTGCAGCAGGG + Intergenic
972797558 4:42437108-42437130 GAGCAGAAACAGATGGTGCTCGG + Intronic
972962765 4:44474108-44474130 GGGCTGAGCCCACTGGAGCTTGG + Intergenic
973199579 4:47485163-47485185 TCGGTCAAACAGCTGGAGCTGGG + Intergenic
973271536 4:48267852-48267874 GAGCTGGAACAGCTGGGGCAGGG + Intronic
973288546 4:48446497-48446519 GGGCTGAAAAAGCTGGTGCTGGG - Intergenic
974520876 4:62978425-62978447 GGGTTCAAACAGCTGGTACTAGG + Intergenic
975387124 4:73770498-73770520 GGGAAGAAGCAGCTGGACCTTGG + Intergenic
976144597 4:82029972-82029994 AGGCAGAAACTGATGGAGCTAGG - Intronic
976824679 4:89248077-89248099 GGACTGTTTCAGCTGGAGCTTGG + Exonic
977069987 4:92373413-92373435 GGGCTGACACAGCTGGGCCATGG - Intronic
978584730 4:110265132-110265154 GAGCTGAGACTGCTGAAGCTGGG + Intergenic
981996263 4:150978164-150978186 GTGCTGAACCACCTGGAGCTGGG - Intronic
984933442 4:184868584-184868606 GGCCTGGACCAGCTGGAGCTGGG + Intergenic
986164976 5:5265352-5265374 GGGCTGAACCAGGGAGAGCTGGG + Intronic
986190329 5:5491144-5491166 CGACTGCAACAGGTGGAGCTGGG + Intergenic
987276950 5:16372789-16372811 GGACTGAAACACCAGGAGGTCGG + Intergenic
992084849 5:73269288-73269310 GTCCTGGAGCAGCTGGAGCTGGG + Intergenic
992601244 5:78402970-78402992 AGGCTGAAACAGCTTGAACCTGG - Intronic
993981383 5:94546495-94546517 GTGCTGAGCCACCTGGAGCTGGG - Intronic
995557708 5:113346126-113346148 GTGCTGAGCCACCTGGAGCTTGG + Intronic
998365586 5:141628681-141628703 GGGCTGAAACAGCTGGGTTGTGG - Intronic
998419520 5:141970757-141970779 GAGCTGAGACTGCTGAAGCTGGG - Exonic
998860722 5:146441044-146441066 GCGCTGAATCATCTGGGGCTGGG + Intergenic
1001722001 5:173864563-173864585 GGGCTCAAACAGCAGGGGCGGGG + Intergenic
1002396749 5:178962868-178962890 GGCCTGTAATAGCTGGAGGTTGG + Intronic
1003314585 6:5001002-5001024 GGAGTGAACTAGCTGGAGCTTGG - Intronic
1003465749 6:6378261-6378283 GAACTGAAATAGCTGAAGCTGGG + Intergenic
1004034724 6:11912439-11912461 GGGCTCACACAGCAGGAGGTGGG + Intergenic
1004628214 6:17396635-17396657 GGGCTGAAGGGGCTGGAGGTGGG + Intronic
1006028205 6:31160820-31160842 GATCTGAACGAGCTGGAGCTGGG + Intronic
1008322585 6:50135120-50135142 TGGCAGAAATGGCTGGAGCTAGG + Intergenic
1011408774 6:87044066-87044088 GGGGTGAAGCAGCTGGACATTGG + Intergenic
1015864916 6:137718183-137718205 GGGCTTAAACATCTGAATCTGGG + Intergenic
1015977486 6:138805660-138805682 TGGCTGAAACAGCTGGGGGCTGG + Intronic
1016786906 6:148020905-148020927 GGGCTGAAGCAGCTGGAAGCAGG + Intergenic
1018784991 6:167101087-167101109 AGGCTGAAGCAGCTCCAGCTTGG - Intergenic
1018917496 6:168145777-168145799 GTGCTGAGGCACCTGGAGCTGGG + Intergenic
1019352393 7:560763-560785 GTGCTGGAACTCCTGGAGCTGGG - Intronic
1022275160 7:28847753-28847775 AAGCTGCATCAGCTGGAGCTGGG + Intergenic
1022472823 7:30692269-30692291 GGGCAGGAAGAGCTTGAGCTGGG - Intronic
1023353062 7:39339660-39339682 GAGCTGGAGCTGCTGGAGCTGGG - Exonic
1024184841 7:46939559-46939581 TGGATGAAACAACTGGAGGTTGG - Intergenic
1024662308 7:51510388-51510410 GTGCTGAGCCACCTGGAGCTTGG + Intergenic
1028172523 7:87615551-87615573 GGGCAGAAACAGCTGGAAGCTGG + Intronic
1029737686 7:102473712-102473734 GAGCTGGAACAGCTGGGGCAAGG + Intronic
1030276704 7:107728717-107728739 GGGCTTTAACAGGTGGAGTTGGG + Intergenic
1030299867 7:107964147-107964169 TGGCTGAAACAGCTGGAGGCTGG - Intronic
1031718895 7:125143777-125143799 GGGCCGAAAAATTTGGAGCTTGG - Intergenic
1031862401 7:126995021-126995043 GTGCTGAACCACCTGGAGCTGGG - Intronic
1032093224 7:128922614-128922636 GGGCTGCTACAGGGGGAGCTTGG - Intergenic
1033589120 7:142796119-142796141 GTACTGGAACGGCTGGAGCTGGG - Intergenic
1034263265 7:149770071-149770093 GGGCCGAGACAGCTGCAGGTGGG - Intronic
1034845607 7:154441676-154441698 GGGCTCTATCAGCTGTAGCTGGG + Intronic
1036206463 8:6809086-6809108 GGTCTGGGAGAGCTGGAGCTGGG + Exonic
1036703553 8:11030099-11030121 GAGCTGGGACAGCTGCAGCTAGG - Intronic
1037683792 8:21120426-21120448 GAGCTGAAGCAGCTGCAGGTAGG + Intergenic
1039647356 8:39302743-39302765 GTTCTGAGCCAGCTGGAGCTAGG + Intergenic
1041802952 8:61819805-61819827 TGGCTGAAAGATCAGGAGCTTGG - Intergenic
1042218074 8:66446427-66446449 GAGCTTAAGCAGCTGCAGCTGGG - Intronic
1044443543 8:92247691-92247713 GGGCTGAAACTGGTGGAATTGGG - Intergenic
1047247694 8:123159072-123159094 TGGGAGAAACAGCTGGATCTAGG - Intergenic
1048010865 8:130455043-130455065 GGGCTGGAACTGCTGAAGATGGG - Intergenic
1048706117 8:137155574-137155596 GTGCTGAACTGGCTGGAGCTAGG + Intergenic
1049616652 8:143578470-143578492 GGGCTGAAACAGCTGGACCCGGG + Exonic
1049659474 8:143813333-143813355 AAGCTGGAACAGCTGGATCTGGG - Exonic
1049807015 8:144545728-144545750 GGGAAGACGCAGCTGGAGCTGGG + Exonic
1049894652 9:101999-102021 GAGCTGAAGCAGCTGCAGCAGGG - Intergenic
1050248283 9:3714382-3714404 GGGCTGAACCACCTGGAACTGGG - Intergenic
1050865029 9:10488008-10488030 GTTCTGAACCACCTGGAGCTGGG + Intronic
1051911449 9:22156671-22156693 GGGCTGAGAGAGCTGGATCTTGG - Intergenic
1053735859 9:41101989-41102011 GAGCTGAAGCAGCTGCAGCAGGG - Intergenic
1053750805 9:41252294-41252316 GTGCTGAGACATGTGGAGCTGGG - Intergenic
1054256320 9:62816637-62816659 GTGCTGAGACATGTGGAGCTGGG - Intergenic
1054334987 9:63798976-63798998 GTGCTGAGACATGTGGAGCTGGG + Intergenic
1054692515 9:68329409-68329431 GAGCTGAAGCAGCTGCAGCAGGG + Intronic
1054924930 9:70579623-70579645 GAACTGAAAAAGCTGCAGCTAGG + Intronic
1055387378 9:75776584-75776606 GTGCTGAGTCACCTGGAGCTGGG - Intergenic
1055423485 9:76168635-76168657 GGACTGAAAGAGCAGGATCTAGG + Intronic
1056963968 9:91150760-91150782 GGGCTGAATCACCTGGCCCTGGG - Intergenic
1057157212 9:92853592-92853614 GGGCTGAGACACATGGACCTGGG + Intronic
1060664067 9:125422521-125422543 GGGAGGAGGCAGCTGGAGCTTGG + Intergenic
1061411783 9:130425820-130425842 GTGCTGCACCAGCTGGGGCTGGG - Exonic
1061462499 9:130751507-130751529 GGGCTGAAAAAGCAGGTTCTTGG + Intronic
1061576818 9:131512569-131512591 GGGCTGCAGGTGCTGGAGCTGGG - Intronic
1061945330 9:133905543-133905565 GGGCCTAGGCAGCTGGAGCTGGG - Intronic
1062052928 9:134456817-134456839 GGGAAGGCACAGCTGGAGCTCGG - Intergenic
1062062314 9:134503025-134503047 GGGCTGAGTCATCAGGAGCTGGG + Intergenic
1062496316 9:136833300-136833322 GGGCTGCCCCAGCTGGATCTGGG + Intronic
1062502787 9:136858458-136858480 GGGCGGATACAGCTGGGACTGGG + Exonic
1186086195 X:5993218-5993240 GGGTTGTTACAGCTGGAGATTGG - Intronic
1186959677 X:14722252-14722274 GGGCTGGAACAGCTGGGAGTTGG + Intronic
1187268764 X:17761149-17761171 TGGCTGCAACTCCTGGAGCTGGG + Intergenic
1187320712 X:18235177-18235199 CGGCTGCAACTCCTGGAGCTGGG - Intergenic
1187527421 X:20066714-20066736 GGGTTTAAACAGATGGAGCAGGG - Intronic
1188060112 X:25590661-25590683 GGGCTGCAGCTGCTGGTGCTGGG - Intergenic
1192443597 X:71193560-71193582 GGGCAGGAACAGCTGGGGCAGGG - Intergenic
1193513275 X:82432622-82432644 GGGCTATGGCAGCTGGAGCTGGG - Intergenic
1194566396 X:95494282-95494304 TGGCTGAAGCAGCTGGGGCACGG - Intergenic
1195242723 X:102968606-102968628 GTGCTGATTGAGCTGGAGCTAGG + Intergenic
1196304753 X:114087788-114087810 GTGCTTAATCACCTGGAGCTAGG - Intergenic
1196459158 X:115912042-115912064 TAGCTGCAACAGCTGGAACTGGG + Intergenic
1198507847 X:137318882-137318904 GGGCTGAAATGGCTGAAGCCAGG - Intergenic
1198773669 X:140156609-140156631 GTTCTGAACCAACTGGAGCTGGG - Intergenic
1200001742 X:153065649-153065671 GGGCAGAAAGAGCAGGAGCAGGG + Intergenic
1200482454 Y:3722416-3722438 GGTCTGAGACACCTGGAGCTAGG - Intergenic