ID: 907678924

View in Genome Browser
Species Human (GRCh38)
Location 1:56545515-56545537
Sequence TCCAGGAACTTCTTGGGATT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 204
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 191}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907678916_907678924 28 Left 907678916 1:56545464-56545486 CCATACGCAATCTAATCTGCAGG 0: 1
1: 0
2: 0
3: 0
4: 47
Right 907678924 1:56545515-56545537 TCCAGGAACTTCTTGGGATTGGG 0: 1
1: 0
2: 0
3: 12
4: 191
907678915_907678924 29 Left 907678915 1:56545463-56545485 CCCATACGCAATCTAATCTGCAG 0: 1
1: 0
2: 0
3: 3
4: 32
Right 907678924 1:56545515-56545537 TCCAGGAACTTCTTGGGATTGGG 0: 1
1: 0
2: 0
3: 12
4: 191

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907678924 Original CRISPR TCCAGGAACTTCTTGGGATT GGG Intronic
901881613 1:12197409-12197431 TTCAGGAAGGTCTTGGGAGTTGG - Intronic
903031948 1:20470007-20470029 TCCTGAACCTTCTTGGGATATGG - Intergenic
903191088 1:21656559-21656581 TCCAGAAGCTTCCTGGGATTGGG - Intronic
903419297 1:23206885-23206907 TCCAGGAACTGGTGGGGAATGGG + Intergenic
906043325 1:42806432-42806454 TCCAGAAATTCCTTGGGAGTAGG - Intergenic
906534646 1:46544704-46544726 TGTAGGAACTTTTTGGGATGAGG + Intergenic
907678924 1:56545515-56545537 TCCAGGAACTTCTTGGGATTGGG + Intronic
908864140 1:68527080-68527102 TTCCTTAACTTCTTGGGATTTGG - Intergenic
910332203 1:86087061-86087083 TGCAGGATCTTCTTGAGATAAGG - Intronic
911275377 1:95853076-95853098 TCCAGGTCCTCCTTGGGCTTGGG - Intergenic
911289823 1:96043828-96043850 TCCATGAAACTCTTGAGATTTGG - Intergenic
915081967 1:153358756-153358778 TCCAGGCACTTATTGGCATTTGG - Intronic
915495778 1:156281999-156282021 TCCAGAGCGTTCTTGGGATTTGG - Intronic
917415073 1:174800448-174800470 TGCTGGAACTTCTGGGGATGGGG + Intronic
917928906 1:179810483-179810505 TCCAGGAACTGCGAGGGATCTGG - Intronic
919777194 1:201201956-201201978 GCCAGGAACTCCATGGGATGAGG - Intronic
922444512 1:225685195-225685217 TCCAGTAAATCCTTGGGACTAGG + Intergenic
923828806 1:237530422-237530444 TCCAGGACTTTGTTGGCATTAGG + Exonic
923980288 1:239313748-239313770 CCCAAGAACCTCTTGGGATATGG - Intergenic
1063868103 10:10388999-10389021 TCCAGCCTCTTCTTGGGAATAGG + Intergenic
1065236924 10:23661407-23661429 TCAAGAAAATTCTTGGGATCAGG + Intergenic
1066445771 10:35481361-35481383 TCCAGGACATTCTTGGACTTAGG + Intronic
1067994425 10:51255528-51255550 TCCCTGATGTTCTTGGGATTTGG + Intronic
1069610468 10:69769323-69769345 TCTAGGAGTTTCCTGGGATTTGG - Intergenic
1070464368 10:76704542-76704564 TCCAGGTATTTGTAGGGATTTGG - Intergenic
1077592710 11:3505117-3505139 TTCAGGATCTGCTTGGGGTTGGG - Intergenic
1078922777 11:15845694-15845716 TCCAGGAAAATCTTGGCAGTAGG - Intergenic
1079001804 11:16763850-16763872 CCCATAAACTTCTTGGAATTTGG - Intergenic
1079737206 11:24012277-24012299 TTCAGGAACTTATTGGGAACTGG + Intergenic
1082742393 11:56925362-56925384 ATCAGGAACTTCTTGGGAACTGG - Intergenic
1084035366 11:66506603-66506625 TCCAGAGGCTTCCTGGGATTTGG + Intronic
1084248540 11:67877837-67877859 TTCAGGATCTGCTTGGGGTTGGG - Intergenic
1084753570 11:71220694-71220716 TCTAGGAACCTCATGGGAGTGGG - Intronic
1084824283 11:71717639-71717661 TTCAGGATCTGCTTGGGGTTGGG + Intergenic
1088391947 11:109324041-109324063 TCTAGGGACTTCTTTTGATTAGG + Intergenic
1088496987 11:110441472-110441494 ACGAGGAACTTGTTGGGAATTGG + Intronic
1088921814 11:114264906-114264928 TCCAGGAACTTCCAGGGATGTGG + Intronic
1088926507 11:114308313-114308335 TGCAGGAACTTCTGAGGATGGGG + Intronic
1088998948 11:115032754-115032776 TCCAGTTGCTTCTTGGGACTGGG + Intergenic
1091885847 12:4016512-4016534 TTTAGGAACTTCTTGAGATCAGG - Intergenic
1092418824 12:8313238-8313260 TTCAGGATCTGCTTGGGGTTGGG - Intergenic
1095689395 12:45070069-45070091 ATGAGGAACTTCTTGGGAATTGG - Intergenic
1098342617 12:69468375-69468397 TCCAGGGACTTCTAGGGGTGGGG + Intergenic
1098490360 12:71068735-71068757 TTCAAGAACTTCTTGGATTTTGG + Intronic
1098806332 12:75024386-75024408 GCAAGGTACTTCTGGGGATTTGG + Intergenic
1099030757 12:77523668-77523690 CCCAGGAAGCTCTTGGGATTGGG + Intergenic
1100549658 12:95635489-95635511 GCCAGGAACTCCTTGGTAGTGGG + Intergenic
1103611757 12:122128296-122128318 TTCAGGAACCTCTGGGGAGTAGG + Intronic
1103830186 12:123772885-123772907 TCCAGGAACTCCTCGGGAAGAGG - Exonic
1103852251 12:123940841-123940863 TCCCGAAACTGCTTGGAATTGGG + Intronic
1107011604 13:35675995-35676017 TCCAGGAAGTTCCAGGGATCCGG - Intergenic
1108005587 13:45942732-45942754 TCCAGGAGCTTCTGGGGAGTGGG + Intergenic
1110433816 13:75457682-75457704 CCTAGGTACTTCTTGTGATTAGG - Intronic
1110616160 13:77544502-77544524 CCCAGGAAATTCTTGGCACTGGG + Intronic
1111358708 13:87145722-87145744 ATGAGGAACTTCTTGGGAATTGG + Intergenic
1112336301 13:98519860-98519882 TTCAGGAACTTTTGGGGATTGGG - Intronic
1115167905 14:30470399-30470421 TCCAGGCAGCTCTTGGGAATTGG - Intergenic
1115260881 14:31452358-31452380 TACAGAAACTTCTTGGAAGTAGG - Intronic
1115277219 14:31622058-31622080 ATGAGGAACTTCTTGGGAATTGG + Intronic
1117333815 14:54739461-54739483 TCCAAGAACTTCCTTGGATTGGG + Intronic
1117990063 14:61424453-61424475 ATGAGGAACTTCTTGGGAATTGG + Intronic
1122534365 14:102451917-102451939 TCCCGGACCTTCTGGGGATGGGG - Intronic
1122796319 14:104207904-104207926 TGCAGGAATTTCTAGGGATGGGG - Intergenic
1127443443 15:59035759-59035781 ACAAGGAACTTCTTGGGAACTGG - Intronic
1128666040 15:69539042-69539064 TACAGGAGCTCCTTGGAATTAGG + Intergenic
1129622094 15:77156982-77157004 TCCAGAAGCTTTTTGTGATTTGG - Intronic
1133358272 16:5153203-5153225 TTCAGGATCTGCTTGGGGTTGGG - Intergenic
1135111859 16:19696519-19696541 TCCAGGAAGCTCTCGGGGTTTGG - Intronic
1136983941 16:35082939-35082961 TCCATGTGTTTCTTGGGATTTGG - Intergenic
1138928466 16:61621609-61621631 GTCAGTAACTTCATGGGATTGGG + Intergenic
1144529497 17:16022465-16022487 TTCAGGATATTCTTGGAATTTGG + Intronic
1145172816 17:20674308-20674330 TTGAGGAACTTATTGGGATCTGG + Intergenic
1146770968 17:35568327-35568349 TCCCGGGAGTTCGTGGGATTTGG + Intergenic
1149569195 17:57660473-57660495 TCCAGGAACTTCCAGGGCTGTGG - Intronic
1151176951 17:72296459-72296481 TCCAAGAGCTTCTTTGGATAAGG + Intergenic
1151515319 17:74590569-74590591 TCCAGGAATTCCTTGGGTTGTGG - Exonic
1155926344 18:31659546-31659568 TCCAAGCACTTCTTTGGAATTGG - Intronic
1158791332 18:60783931-60783953 ATCAGGAACTTCTTGGGAGCTGG + Intergenic
1159184492 18:64950817-64950839 TCCAGGAATTTCTTCCAATTGGG + Intergenic
1161034510 19:2076986-2077008 TGCAGGAAGTTCTTGGGAAACGG + Exonic
1161779010 19:6279358-6279380 TCCAGGCACTTCCTGGGATCTGG - Intronic
1163053327 19:14701098-14701120 TCCAGTAGCTCCTTGGGATCAGG + Intronic
925786804 2:7439297-7439319 TCTAGGAACTCCTTGGGAGAGGG - Intergenic
926272309 2:11375916-11375938 TCCAGGTACTTCTGGGCAGTTGG + Intergenic
926368954 2:12161449-12161471 TCCAGGAACTTCCTTTAATTTGG + Intergenic
926624479 2:15079674-15079696 TCCAAGAACATCGTGGGAATGGG - Intergenic
929197244 2:39197476-39197498 TCCCTGATGTTCTTGGGATTTGG - Intronic
929865052 2:45710604-45710626 TCCTGCCACTTCTTGGGACTGGG - Intronic
931176797 2:59862275-59862297 ATGAGGAACTTCTTGGGAATTGG - Intergenic
932185709 2:69693712-69693734 TCCAGGAACCCCCTGGGAGTGGG - Intronic
933064968 2:77781195-77781217 ATGAGGAACTTTTTGGGATTTGG + Intergenic
940511059 2:154615634-154615656 TCCAAGAAGTTCTTGGGACCTGG + Intergenic
941754295 2:169168145-169168167 TCCAGGAAGCTCTAGGGGTTTGG + Intronic
944330305 2:198457865-198457887 TCCTGGAACCTCTTGGGTTGTGG - Intronic
946465811 2:219910993-219911015 TCTGGGACCTTCTTGGGATAGGG - Intergenic
946653405 2:221918520-221918542 GCAAGGAAATTCTTGGAATTGGG + Intergenic
948384825 2:237574900-237574922 TCCAGGAACATCTAGGGCTCGGG + Exonic
949024863 2:241762501-241762523 GCCTGGCACTTCTTGGGCTTTGG + Intronic
1168793060 20:592903-592925 TCCATGAACTTTTTGGGCATGGG + Intergenic
1169469419 20:5871376-5871398 TCCAGCAGCTTCTTGTGTTTTGG - Intergenic
1170120213 20:12903320-12903342 TCCTTGAACTTCTTTGTATTTGG - Intergenic
1170972439 20:21128437-21128459 TCCAGAAACTTCTGGGAAGTGGG + Intronic
1174004120 20:47396700-47396722 ATCAGGAACTTTTTGGGCTTTGG + Intergenic
1178716456 21:34968664-34968686 TCCAGAAACTCCTGGGGTTTGGG - Intronic
1179956628 21:44744050-44744072 TCCAGGAACTCCATGCTATTGGG + Intergenic
1181842471 22:25675691-25675713 CTCAGGCACTTCCTGGGATTGGG + Intronic
1182317682 22:29458922-29458944 CCCATTAACTTCATGGGATTTGG - Intergenic
1183213807 22:36466621-36466643 TGCAGGAACTTCTGGGCCTTGGG - Intergenic
1183965049 22:41436561-41436583 TACACGAACTCCTTGGCATTGGG + Exonic
949408018 3:3735037-3735059 TCCAGGCACTTCCTGGGCATTGG - Intronic
950716928 3:14854310-14854332 TCCAGGAAATTCTGGGCATGTGG - Intronic
950856751 3:16112881-16112903 TCCAGAAACTCCATGTGATTGGG - Intergenic
952189957 3:31012390-31012412 TCCAGCAAATTCTTGGTATATGG + Intergenic
952982275 3:38746593-38746615 TCTAGGAGTTTCTTGGGATCTGG + Intronic
953655170 3:44845708-44845730 TGCAGGAATTTCTTGTGATAAGG - Intronic
953655796 3:44853363-44853385 TCAAGGAACTTCTGTGTATTGGG + Intronic
954645396 3:52128400-52128422 CCCTGGAACTTCCTGGGGTTTGG - Intronic
955809423 3:62770795-62770817 TCCAGGAGCTTCTGGGGTCTGGG - Intronic
959172609 3:102860714-102860736 ATAAGGAACTTCTTGGGAATTGG - Intergenic
961290608 3:125843625-125843647 TTCAGGATCTGCTTGGGGTTGGG + Intergenic
961422092 3:126814611-126814633 TCCAGGAACTTCTAAGTGTTCGG - Intronic
961809004 3:129510699-129510721 TCCAGGACCTACATGGGACTAGG + Intronic
961896504 3:130172460-130172482 TTCAGGATCTGCTTGGGGTTGGG - Intergenic
962068699 3:132010868-132010890 GCCAGGAAGTTCTTGGGGTTTGG - Intronic
962101007 3:132342592-132342614 GCCAGGACCTTTTTGGAATTTGG + Exonic
962481859 3:135804916-135804938 ACCAGGATCTGCTTGGGATCAGG - Intergenic
964704472 3:159603263-159603285 TCCAGGAACTTCCATGTATTTGG + Intronic
966888958 3:184392456-184392478 TCCAGGGACCTCCTGGGAGTGGG + Intronic
967403783 3:189094118-189094140 TCCATGAAATTCTTGGGTTCAGG + Intronic
968296583 3:197581526-197581548 CCCAGGAACTTCTCCGCATTAGG - Intergenic
970303334 4:14704187-14704209 TCCAAGAAGTTCTTGGAACTTGG + Intergenic
970349557 4:15188424-15188446 ATGAGGAACTTCTTGGGAATGGG - Intergenic
976389107 4:84491675-84491697 TCCAGGAAGTCCCTGGGGTTGGG - Intergenic
979238839 4:118430651-118430673 TCTAGGATCATATTGGGATTAGG - Intergenic
979519329 4:121648652-121648674 TCCAGGCACCTCATGGGACTTGG - Intergenic
981354254 4:143768994-143769016 ACCAGGAACTTCTTGTGGTGGGG - Intergenic
981435422 4:144715394-144715416 TCCGGTCACATCTTGGGATTTGG + Exonic
987431682 5:17842776-17842798 ATGAGGAACTTCTTGGGAATTGG - Intergenic
987984820 5:25133432-25133454 ATGAGGAACTTGTTGGGATTTGG + Intergenic
988386447 5:30572436-30572458 ACCACAAACTTCTTGGCATTTGG - Intergenic
989618225 5:43358621-43358643 TCCAGCAACTGCTGGGAATTAGG + Intergenic
990108517 5:52293791-52293813 ATGAGGAACTTCTTGGGAATTGG - Intergenic
992689480 5:79228931-79228953 TCCAGGAACTTCTGGAGACAGGG + Intronic
993614632 5:90096539-90096561 ACCAGGAATTTCTTGGGAAGGGG - Intergenic
995521835 5:113014721-113014743 TGAAGGAATTTCTTGGGAGTCGG + Exonic
996411975 5:123168479-123168501 TACTGGACCTTCTTGGGACTCGG + Intronic
998188095 5:139998370-139998392 TCCAGGACTTTCTTGGCCTTGGG - Intronic
1002583939 5:180229495-180229517 TCCAGGAAATCCTGGGGATGGGG + Intergenic
1005340950 6:24843304-24843326 TCCAGGAACTCCCTGGGAGAAGG - Exonic
1006880170 6:37332272-37332294 TCCAGGAAAGTCTGGGGGTTGGG - Exonic
1010197967 6:73258782-73258804 TCCAGCAACTGCTGGGAATTAGG - Intronic
1013010942 6:106119395-106119417 TCCAGTAACTTGTTGGCTTTAGG + Intergenic
1013927952 6:115495162-115495184 TTGAGGAACTTCTTGGGAACTGG - Intergenic
1014633692 6:123818466-123818488 TGCAGAACCTTCTTGGGTTTGGG - Intronic
1015882333 6:137881591-137881613 GCCAGGAACTTCTTTGGACTTGG + Exonic
1015949945 6:138542208-138542230 TCCAGGCATTTCTTGGCTTTCGG - Intronic
1018320485 6:162603006-162603028 TCCTGGAGCTTCTGGGGTTTGGG - Intronic
1019209123 6:170390812-170390834 TCGAAGAACCTCTTGGGATGTGG + Intronic
1020327192 7:6984070-6984092 TTCAGGATCTGCTTGGGGTTGGG - Intergenic
1021632951 7:22664841-22664863 GCCAGGAACTTCTTATGTTTCGG - Intergenic
1024262588 7:47583075-47583097 ACCAAGAACTGCTTTGGATTCGG + Intergenic
1029964436 7:104724092-104724114 TGCAGGTACTTCTTAGGATTAGG + Intronic
1030141108 7:106304747-106304769 TCCAGGAAGTTCAAGGGGTTGGG - Intergenic
1032837168 7:135685031-135685053 TCCGGGAAGTTCTGAGGATTGGG - Intronic
1033012662 7:137639415-137639437 ACCTGGAACCTTTTGGGATTGGG + Intronic
1033586483 7:142778517-142778539 TCCAGGTACAGCTTGGGATGTGG - Intergenic
1033790067 7:144781389-144781411 GCCAGCAACTTCTTAGGAGTGGG - Intronic
1033929781 7:146507451-146507473 AACAGGAATTACTTGGGATTGGG - Intronic
1036369426 8:8149986-8150008 TTCAGGATCTGCTTGGGGTTGGG + Intergenic
1036881463 8:12515654-12515676 TTCAGGATCTGCTTGGGGTTGGG - Intergenic
1037977136 8:23221724-23221746 TCCAGGAATTTTTTGAGACTGGG - Intronic
1039211777 8:35224792-35224814 TCCAGGGACTTTCTGGGATCTGG - Intergenic
1039744328 8:40410419-40410441 TAGAGGAACTTCCGGGGATTGGG - Intergenic
1041648276 8:60276068-60276090 TCCAGGAACTTCCTGAGAAAAGG - Intronic
1045773810 8:105777503-105777525 TCCTAGAACTTCTTGGGAGAAGG - Intronic
1045782666 8:105886107-105886129 TCCAGAAAATTCATGGGATAGGG + Intergenic
1048153917 8:131922918-131922940 TCCAGGAACTTTTTTGTAATTGG + Intronic
1048872073 8:138807419-138807441 TCCAGAAACTTTTAGGGGTTGGG - Intronic
1052138426 9:24945175-24945197 TCAAAGACCTTGTTGGGATTGGG - Intergenic
1053553446 9:39108355-39108377 TACAGAAACTGCTTGGTATTAGG + Intronic
1053817548 9:41928512-41928534 TACAGAAACTGCTTGGTATTAGG + Intronic
1054107804 9:61072184-61072206 TACAGAAACTGCTTGGTATTAGG + Intergenic
1054613053 9:67258941-67258963 TACAGAAACTGCTTGGTATTAGG - Intergenic
1058746087 9:107991947-107991969 TCTAAGAATTTCTTGGGTTTTGG - Intergenic
1062137781 9:134938791-134938813 TCCAGGAGCTTCTAGGGGCTGGG - Intergenic
1185620437 X:1450497-1450519 TCCAGGACCTCCTAGGGATAAGG - Intronic
1191051841 X:56201984-56202006 TTCAGGACTCTCTTGGGATTCGG + Intergenic
1191198948 X:57757162-57757184 TCCTGCAACTTTTTGGAATTTGG - Intergenic
1192487704 X:71544383-71544405 TTTTGGAACTTTTTGGGATTTGG + Intronic
1193542370 X:82788093-82788115 TTCAGGAACTTGTTGGGAACTGG + Intergenic
1195134489 X:101890860-101890882 TACAGGAACTTCTTAAAATTTGG + Intronic
1196981002 X:121213617-121213639 TCCACTCACTTCTTGGGATGTGG + Intergenic
1198956186 X:142134407-142134429 TTGAGGAACTTCTTGGGAAATGG + Intergenic
1199480847 X:148297064-148297086 ACGAGGAACTTCTTGGGAATTGG + Intergenic
1200684772 Y:6248270-6248292 TCCAGGACGTTCATGGCATTGGG + Intronic
1200990302 Y:9339535-9339557 TCCAGGACGTTCATGGCATTGGG + Intronic
1200992963 Y:9359850-9359872 TCCAGGACGTTCATGGCATTGGG + Intronic
1200995617 Y:9380128-9380150 TCCAGGACGTTCATGGCATTGGG + Intronic
1200998282 Y:9400474-9400496 TCCAGGACGTTCATGGCATTGGG + Intronic
1201000790 Y:9469006-9469028 TCCAGGACGTTCATGGCATTGGG + Intronic
1201003458 Y:9489338-9489360 TCCAGGACGTTCATGGCATTGGG + Intronic
1201006114 Y:9509620-9509642 TCCAGGACGTTCATGGCATTGGG + Intergenic
1201008772 Y:9529933-9529955 TCCAGGACGTTCATGGCATTGGG + Intronic
1201011348 Y:9550102-9550124 TCCAGGACATTCATGGCATTGGG + Intergenic