ID: 907680109

View in Genome Browser
Species Human (GRCh38)
Location 1:56555195-56555217
Sequence CCATTTCCACTCCTCCATCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 257
Summary {0: 1, 1: 0, 2: 0, 3: 26, 4: 230}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907680104_907680109 24 Left 907680104 1:56555148-56555170 CCACTCACAGGCTTCAATCTCAG 0: 1
1: 0
2: 3
3: 18
4: 302
Right 907680109 1:56555195-56555217 CCATTTCCACTCCTCCATCATGG 0: 1
1: 0
2: 0
3: 26
4: 230

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907680109 Original CRISPR CCATTTCCACTCCTCCATCA TGG Intronic
901879043 1:12183171-12183193 CCATTTCCCCTCCTCCAGATTGG - Intronic
904751512 1:32743450-32743472 CCAAATCCAGTCCTCCCTCAGGG - Intronic
905316731 1:37086741-37086763 CCATGTGCACTTCTCCAACAGGG - Intergenic
905792710 1:40798846-40798868 CCACTTGCCCTCCTGCATCAAGG + Intronic
905854842 1:41302829-41302851 CAATTTCCACTCCTACAGAAGGG - Intergenic
905934883 1:41815538-41815560 CCATTCCCATTCCTACCTCAGGG - Intronic
906141969 1:43539341-43539363 CCAATTCCACTCCTCCTCCAGGG - Intronic
906927013 1:50128635-50128657 CCTTCTCCAATCCCCCATCATGG - Intronic
907680109 1:56555195-56555217 CCATTTCCACTCCTCCATCATGG + Intronic
909109637 1:71458196-71458218 CAAATTCCATTGCTCCATCAAGG + Intronic
911121576 1:94302199-94302221 CAAGTTCCACTGCACCATCAAGG + Intergenic
912495449 1:110088729-110088751 CCTGTCCCACTCCTCCATCCTGG + Intergenic
913079092 1:115365117-115365139 CTATTTCCCCTTCTCCTTCATGG + Intergenic
915910210 1:159910289-159910311 GCATTTCAACTCCTCATTCATGG - Intergenic
918354965 1:183699317-183699339 CCATCTACAGTCCTACATCAAGG + Intronic
919218818 1:194598425-194598447 CCTTTCCTACTGCTCCATCAGGG - Intergenic
920691360 1:208148849-208148871 ACATTTCCACTCCTGCATTTTGG - Intronic
921254388 1:213325961-213325983 CCATTTCCCCTCCCTCTTCAGGG + Intergenic
922749779 1:228064958-228064980 CCCTTGCCCCTGCTCCATCATGG + Intergenic
922816110 1:228450594-228450616 CCCTCTCCACCCCTCCATCCTGG + Intergenic
922966050 1:229691824-229691846 CCATCTACATGCCTCCATCATGG - Intergenic
1063542290 10:6945879-6945901 CCTTGTCCACTTCTCCATCACGG - Intergenic
1065087648 10:22195961-22195983 CCATTTCCTCTGCTCCAAGAAGG - Intergenic
1066379484 10:34889118-34889140 CCATTTCCAGCACACCATCAGGG + Intergenic
1067725831 10:48770172-48770194 CAATTTTCTCTCCTCCATTACGG + Intronic
1067754998 10:48998794-48998816 ACATTCCCACCCCTCCCTCAAGG + Intergenic
1067943383 10:50675102-50675124 CCATTTCCACATCTCCAGCGGGG - Intergenic
1070626408 10:78054203-78054225 CCCTTCCCACTCCTTCTTCATGG - Intronic
1070864714 10:79700852-79700874 CCATTTCCACATCTCCAGCGGGG - Intergenic
1070878500 10:79838980-79839002 CCATTTCCACATCTCCAGCGGGG - Intergenic
1071595636 10:86921613-86921635 CCACTTCCAGCCCTACATCATGG + Exonic
1071631613 10:87223070-87223092 CCATTTCCACATCTCCAGCGGGG - Intergenic
1071645057 10:87355290-87355312 CCATTTCCACATCTCCAGCGGGG - Intergenic
1072482603 10:95823692-95823714 ATATTTCCACTTCTTCATCATGG + Intronic
1072988184 10:100162390-100162412 CCATTTCCACACATCCTTCTTGG - Intronic
1073010395 10:100354643-100354665 CCATATCCCCACCTCCATCAGGG - Intronic
1073370488 10:102984251-102984273 ACAATTCCACACATCCATCAGGG - Intronic
1075492211 10:122880746-122880768 CGATTTCTTCACCTCCATCAGGG - Intergenic
1075498668 10:122952935-122952957 CGATTTCTTCACCTCCATCAGGG + Exonic
1076499060 10:130921596-130921618 CCCTCTCCACCCCTCCATCCTGG + Intergenic
1077129682 11:964789-964811 CCATTTCCACGCTTCCATCTGGG - Intronic
1077129692 11:964848-964870 CCATCTCCACGCTTCCATCTGGG - Intronic
1078008284 11:7548894-7548916 CCACTTCCACTCCTCCAATTGGG - Intronic
1078038719 11:7836817-7836839 CCTTTTCCATTTTTCCATCATGG + Intergenic
1078093397 11:8281751-8281773 CCATTTCCACACTTCCTTCTTGG + Intergenic
1079219521 11:18547755-18547777 TTATTTCCACTCCTCCCTGATGG - Intronic
1079347386 11:19664785-19664807 CCATTTCCTCTCCTTCATTTGGG - Intronic
1079418093 11:20259535-20259557 GTATTTGCACTTCTCCATCAGGG + Intergenic
1084323791 11:68387724-68387746 CCACTGCGCCTCCTCCATCAGGG - Intronic
1084601811 11:70150133-70150155 CCATTTCCTCTCCACCCCCACGG - Intronic
1086008676 11:82071499-82071521 CAAATTACCCTCCTCCATCAAGG + Intergenic
1087356358 11:97098691-97098713 TCACTTCCACTCCTCCATAGGGG - Intergenic
1089112872 11:116071108-116071130 TCATTTCCACTCATCTATAATGG - Intergenic
1089834927 11:121362167-121362189 CCACTTCCAGCCCTACATCATGG - Intergenic
1089871865 11:121682154-121682176 CAATCCCCACTTCTCCATCAAGG - Intergenic
1089971763 11:122699175-122699197 CCCATGCCCCTCCTCCATCAGGG - Intronic
1091013852 11:132031434-132031456 CCATCCCCACTCCTACACCATGG - Intronic
1091773641 12:3169981-3170003 ACATTCTGACTCCTCCATCAGGG - Intronic
1092006632 12:5075708-5075730 TCAGTTCCTCTCCTCCATCCGGG + Intergenic
1093177076 12:15924751-15924773 CCATTTCACCTCCTCCCTGAAGG + Intronic
1096845764 12:54405599-54405621 CCATTCCCACTCTTCCCTCTTGG + Intronic
1097155291 12:57007484-57007506 TCCTTTCCACTTATCCATCAAGG - Intergenic
1097569340 12:61312825-61312847 CCATCCCTACTCCTTCATCAAGG - Intergenic
1103750515 12:123155911-123155933 CCCTTTCCACTCCTTCACCCTGG - Exonic
1103898012 12:124286667-124286689 CCATTTCCATTCATTCCTCAAGG - Intronic
1104185904 12:126431021-126431043 CCAGTTCTGCTCCTCCATCTTGG + Intergenic
1106578385 13:30997180-30997202 ACATTTCCACCCTTCCGTCAAGG - Intergenic
1106952892 13:34904710-34904732 CGAATTCCACTCCCACATCACGG - Intergenic
1110538273 13:76678060-76678082 CCCATTCCCTTCCTCCATCACGG - Intergenic
1110759077 13:79210228-79210250 CCATTTCCTCTCCTCCAGGTGGG + Intergenic
1117471117 14:56046011-56046033 CCATTTCCACCCCTCTTTTATGG - Intergenic
1118324882 14:64773999-64774021 CCACCTGCACTCCTACATCATGG + Intronic
1118404896 14:65413116-65413138 CCCTTCCCACTCCCCCATCGTGG + Intronic
1118935382 14:70283311-70283333 CCATTGCCACTCAGGCATCACGG - Intergenic
1120034902 14:79685672-79685694 TCATTTCTCCTCCTCTATCAAGG - Intronic
1120102446 14:80460924-80460946 CAATTTCCCCACCCCCATCAAGG - Intergenic
1120849377 14:89155589-89155611 CTCTTTCTACTCCTCCAGCACGG + Intronic
1125747624 15:42007971-42007993 CCAGTTCCTCTCCTCATTCATGG + Intronic
1131337566 15:91564052-91564074 CCCTTTTCACTTCTCCATCTTGG - Intergenic
1131373649 15:91905567-91905589 CCATTTCCACAGGTCCATCCAGG - Intronic
1132115223 15:99131153-99131175 CGAATTCCACACCTCCATGAAGG + Exonic
1135626615 16:24000685-24000707 CCATTTCCATTGCTCCACCTAGG + Intronic
1135721256 16:24820454-24820476 CTATTGCCTCACCTCCATCAGGG + Intronic
1136995157 16:35184023-35184045 CCATTTCCCATCCTTCATCTTGG + Intergenic
1138475887 16:57270432-57270454 CTATTCCCACTGCTCCATCCAGG + Intronic
1138848657 16:60599134-60599156 CCATTCTCACTGCTCCACCAAGG - Intergenic
1138910642 16:61394043-61394065 TCACTACCACTCCTCCATCTAGG - Intergenic
1139303342 16:65963341-65963363 CCATTTCCTCTCCTGCAAAATGG + Intergenic
1140922659 16:79553264-79553286 CCATTGCCACCTCTCCATCATGG + Intergenic
1141509509 16:84503752-84503774 CCCTGTCCACCCCTCCATCACGG - Intronic
1142372665 16:89691719-89691741 CCATGTCCCCTCCTGCAGCAGGG + Intronic
1145935481 17:28712294-28712316 CCATTTCCCCTCCACCTTCCGGG + Intergenic
1146371424 17:32267097-32267119 CCCTGCCCACTCCTCCCTCAGGG + Intronic
1146665317 17:34698469-34698491 CCACTTCCACTGCTGCATCCTGG - Intergenic
1147816691 17:43215748-43215770 ACTTTTCCATTCCTCCATCCTGG + Intronic
1150758434 17:67937620-67937642 CCAGGTCCACTCCTGCCTCAGGG - Intronic
1150959615 17:69899552-69899574 CCATTTTCACTCTTCCAACAAGG - Intergenic
1151255702 17:72874717-72874739 CCACTTCCTCCTCTCCATCAAGG - Intronic
1152195539 17:78916188-78916210 CCACTTCCACACCTCCAAAAAGG - Intronic
1153828520 18:8899166-8899188 CCATGTCAACTCCTGCATGATGG - Intergenic
1154286506 18:13062227-13062249 CTAGTTCCACTCCTCCAAGAAGG - Intronic
1155359572 18:24986475-24986497 ACATTTCCATTTTTCCATCAAGG - Intergenic
1157803411 18:50639223-50639245 CCATTTCCAGTCATCCAGCTTGG - Intronic
1157999953 18:52606643-52606665 CTCTTTCCACCCCTCCATCAGGG - Intronic
1158848002 18:61464864-61464886 CCAGTTAGAATCCTCCATCATGG + Intronic
1161238173 19:3208146-3208168 CCATGTCCACGCCACCATCGGGG - Exonic
1162366355 19:10252037-10252059 CAATTTTCACTCCTGCCTCAAGG - Exonic
1164456293 19:28410057-28410079 CCAGTTCCTCTCCACCCTCAAGG + Intergenic
1164792522 19:31000460-31000482 CCACTACCACTCCTCCACTATGG - Intergenic
1166232461 19:41433197-41433219 CCACTTCCTCTCCTGCATCTGGG + Intronic
1166894379 19:46014983-46015005 CCATTCCCACTACTCCATGGGGG - Intronic
1167272257 19:48511989-48512011 CCATTTCCTCCCCTCCCTCCTGG - Intronic
1168318971 19:55497772-55497794 TCCTTTCCACTCATCCATCTAGG - Intronic
924983665 2:247546-247568 CTATTTCAAATCCTCCACCAAGG + Exonic
927096902 2:19754304-19754326 CCATTTCCACTCCAGCACCATGG - Intergenic
928983901 2:37162029-37162051 CTAGTTCCACTCCTCCTCCACGG - Intergenic
930229459 2:48828123-48828145 CCTTATCCACACCTCCAACAAGG + Intergenic
930270927 2:49255782-49255804 TCATTTCAACTCAGCCATCATGG + Intergenic
931012348 2:57931028-57931050 TCATGTCCACTCATCCATCAAGG + Intronic
932941792 2:76175294-76175316 CTATTTCCATCACTCCATCATGG + Intergenic
933119467 2:78518735-78518757 CCATTTCCTCACCCCTATCAGGG + Intergenic
933491758 2:82993378-82993400 TCATTTACACACCTCCATCAGGG - Intergenic
933795409 2:85915475-85915497 CCATTTCCTCACCTGTATCACGG + Intergenic
935603035 2:104941909-104941931 TGATTTCCACTCTTTCATCATGG - Intergenic
936521079 2:113212550-113212572 CCACTTCCCCTCCTCCTCCATGG - Intergenic
937397205 2:121547335-121547357 CCTTATCCACACCTCCAACAAGG + Intronic
937653504 2:124347436-124347458 CTCTTTCCCCTCCTCCACCAGGG + Intronic
938107135 2:128540152-128540174 CTAGTTCCACTCCTTCATCTAGG - Intergenic
938308423 2:130269416-130269438 CTATTTCTGCTCCTCCTTCAGGG + Intergenic
938446906 2:131387420-131387442 CTATTTCTGCTCCTCCTTCAGGG - Intergenic
939116151 2:138063246-138063268 CAATTTCCACTCCTCCAGCTAGG - Intergenic
940490524 2:154353566-154353588 CCATTTTCTCTCCTCCACCCTGG + Intronic
941334128 2:164220181-164220203 CCACTCCCCCTACTCCATCATGG + Intergenic
942937520 2:181575731-181575753 CCATTTCAACTTCCTCATCAAGG + Intronic
943762935 2:191629547-191629569 CTTTATCCATTCCTCCATCAAGG + Intergenic
944001678 2:194846592-194846614 TCATTTTCACTGCTTCATCAAGG + Intergenic
945984463 2:216342581-216342603 CCATTCCCACTTCTCCATGCAGG - Intronic
946272525 2:218606126-218606148 CCATTTCTACTTCCCCAACATGG - Intergenic
946749250 2:222876897-222876919 TTATCTCCCCTCCTCCATCAAGG - Intronic
947007735 2:225531326-225531348 AAATTTCCACTCATCCCTCAAGG + Intronic
947595789 2:231410785-231410807 CCAGTTCCACTCTTCCCCCAGGG + Intergenic
948718318 2:239880587-239880609 CAATTTCCACCCCACCAGCAAGG + Intergenic
1170042098 20:12049809-12049831 CCATACACACTCCTCCATTATGG + Intergenic
1170404336 20:16020327-16020349 CCATTCCCATTCATCCTTCAGGG + Intronic
1170528646 20:17267053-17267075 CCATGTCCACTCTTCCAGAAAGG - Intronic
1171277991 20:23874948-23874970 CCATTTCCTCTCCACCCCCATGG - Intergenic
1172860519 20:38046637-38046659 TCAATTCCTCTCCTCCTTCAGGG - Intronic
1173799505 20:45886375-45886397 CAAATTCCAGTCCTTCATCAGGG - Intergenic
1177802347 21:25840309-25840331 CCCTTCCCACTCTTCCATCAAGG + Intergenic
1180052073 21:45335837-45335859 CCTTTTCCTCCCCTCCATCCAGG + Intergenic
1181116606 22:20635676-20635698 CCATTTCCTCCCCTCCCCCAAGG - Intergenic
1181406435 22:22688188-22688210 TCGTTTGCACTCTTCCATCATGG - Intergenic
1183420893 22:37710625-37710647 CCATTTGCACTCCTTCCCCAAGG + Intronic
1183831642 22:40421219-40421241 CCATTTCCACTCTTCCCTGTGGG + Intronic
949844801 3:8358373-8358395 CCATTTCTACATCTCCATCCAGG - Intergenic
950398820 3:12754623-12754645 CCATCCCCAATCCTCCATCCTGG + Intronic
951847301 3:27098045-27098067 GCCTTTGCTCTCCTCCATCATGG - Intergenic
951848565 3:27112530-27112552 CCGTTTTCACTCCTTCACCAGGG - Intronic
952216903 3:31287345-31287367 CCAGTTCCTCTCCTCCTTCCAGG + Intergenic
952979560 3:38723734-38723756 CCATTGCCAGCACTCCATCAGGG - Intronic
953150842 3:40322942-40322964 CCATTTCCCCTCCTTGATCTAGG + Intergenic
953822733 3:46222254-46222276 CCATCTCCCCACCTCCACCATGG - Intronic
954091703 3:48289489-48289511 CCACATCCACTGCTCCATCCTGG - Intronic
955205039 3:56888212-56888234 CCATTTCCACTCCTACGAAAAGG + Intronic
956173619 3:66453056-66453078 CCATTTCCCATCCTCACTCAGGG + Intronic
959975054 3:112449479-112449501 CAATTCCAACCCCTCCATCAAGG + Intergenic
960538038 3:118834602-118834624 CCATTACCACTGCTCCACCAAGG + Intergenic
962845668 3:139271581-139271603 CCATTTCCACTTCCCCGTCTGGG - Intronic
967331518 3:188294996-188295018 GCTTTTCCCATCCTCCATCAGGG + Intronic
968041431 3:195592336-195592358 TCATTTCCACTCCTACAACACGG + Intergenic
969919828 4:10527280-10527302 CAACTCCTACTCCTCCATCAGGG + Intronic
970604280 4:17664967-17664989 TCATTTCCACTCCTCCCTGATGG - Intronic
973147670 4:46847880-46847902 CCACTTCCACTCCAGCCTCAAGG + Intronic
974404481 4:61448309-61448331 CTATCTCCACTCCTCCTTCCTGG - Intronic
974732857 4:65892058-65892080 ACATTTCAACTCCTCTATGAAGG + Intergenic
978532568 4:109729924-109729946 CCATATCCACGCCTCCTTCCCGG + Exonic
982422548 4:155214271-155214293 CATTTTCCACTCCCCCATTAAGG - Exonic
982842087 4:160201994-160202016 CAATTCCCACTCCTCCATCTTGG + Intergenic
984692116 4:182738649-182738671 CCATTTCTAATCCTACAGCATGG - Intronic
985143077 4:186863149-186863171 CCATTTCCTCTCCTCCTCCCTGG + Intergenic
986774613 5:11002446-11002468 CCTTTCCTCCTCCTCCATCAAGG - Intronic
987783732 5:22471515-22471537 CCATTTCCACTCCACATACAAGG + Intronic
988499965 5:31776302-31776324 CCATTGCCACTCCCCTATCCAGG + Intronic
989149904 5:38289030-38289052 CTATTCCCACTCCCCCATAAGGG - Intronic
990292178 5:54363357-54363379 CAATTTCTACTCCTCCCCCATGG - Intergenic
992102706 5:73422578-73422600 CAATTTCCACCCCACCTTCAAGG + Intergenic
993251498 5:85530691-85530713 GAATTTCCTCCCCTCCATCATGG - Intergenic
998285970 5:140861310-140861332 CCAGTTCCACTACACCATCCTGG + Intronic
998384777 5:141750503-141750525 CCATTTCCCTGCCTCCTTCAAGG + Intergenic
1001707644 5:173753401-173753423 CCATCTCCACTGCTGCATCCAGG - Intergenic
1002397234 5:178967527-178967549 TCATTTCCTCTCCTCCATCTGGG + Intergenic
1003889266 6:10549457-10549479 CAATTCACACTTCTCCATCAGGG + Intronic
1005664074 6:28032170-28032192 CCATTTCCACCTCTACATCAAGG - Intergenic
1005798616 6:29394760-29394782 CCTTTACCACACCTCCATGAAGG - Intronic
1005884670 6:30087822-30087844 CCATGTCCACTTCCCCATCGGGG + Intergenic
1007251409 6:40497667-40497689 CAGTTTCCACACCTGCATCAAGG + Intronic
1007275504 6:40670482-40670504 CAATTTCTACTTCTCCATCTGGG + Intergenic
1007309544 6:40934631-40934653 CCATTCCCTCTCCTCCTCCAGGG - Intergenic
1007358131 6:41335543-41335565 CCTTTTCAGCTCCTCCCTCAGGG + Intergenic
1007556226 6:42768750-42768772 CCATTACCACTTCTCCAAAATGG + Intronic
1010178343 6:73055605-73055627 CCATTTCCCCTCCTTGATCTGGG - Intronic
1010960402 6:82139300-82139322 TCATTTCCTCTCCTCTATCTAGG + Intergenic
1012945829 6:105464500-105464522 CACTTGCCACTCCTCCACCATGG - Intergenic
1013158106 6:107513211-107513233 CCATTTCCTGTCCTCCAGGATGG + Intronic
1013159871 6:107532729-107532751 CCATTACCATCCCTCCATCCAGG + Intronic
1013803011 6:113969170-113969192 CCATCTCCACCCCTCCACGATGG + Intronic
1014789931 6:125660904-125660926 TCACTTCCACCCCTTCATCAAGG + Intergenic
1014845894 6:126276538-126276560 TCATCTCCACTTCTCCCTCAAGG - Intergenic
1015075938 6:129157840-129157862 CCACTTCCAGCCCTACATCATGG - Intronic
1016014406 6:139168964-139168986 CCATCTCCACCCCTCCATGAAGG + Intronic
1017541804 6:155410493-155410515 CCATTTTAACTCCTCAAACAGGG - Intronic
1017878265 6:158541607-158541629 CCGTTTCCACGCCTCCATGCTGG + Intronic
1018648248 6:165968122-165968144 GCAGTGCCCCTCCTCCATCAGGG + Intronic
1021318006 7:19174515-19174537 TCATTTCCACTGCTCCAAGAAGG - Intergenic
1021944575 7:25714225-25714247 CCAATCCCACTCCTCCCTCAAGG + Intergenic
1022421376 7:30226664-30226686 TCACTTGCAATCCTCCATCATGG - Intergenic
1022483682 7:30761019-30761041 CCATCTCCACTCCTAAGTCATGG + Intronic
1022981132 7:35605928-35605950 CCATTACCACTTCTCCCCCAAGG + Intergenic
1023659348 7:42456753-42456775 CAATCCCCACTCCTCCCTCAGGG - Intergenic
1024535619 7:50429051-50429073 CAACTTCCACTGCTTCATCAAGG + Intergenic
1026050249 7:66940618-66940640 CCACTTCCCCTCCTCCCTCCTGG - Intronic
1029306010 7:99620525-99620547 CCTTTCCCAGTCATCCATCAGGG - Intronic
1029797455 7:102910242-102910264 CCAGTGCCACCCCTCCAACATGG - Intronic
1032099485 7:128961926-128961948 TCATTTCCATTTCTCCATCTTGG - Intronic
1035045414 7:155962379-155962401 CCCCTTCCTCTCCTCCATCAAGG + Intergenic
1035174430 7:157040195-157040217 CCACTTCCACGCCTCCCTCACGG - Intergenic
1037535860 8:19823683-19823705 TAATTTCCACTACTTCATCATGG - Intronic
1038895217 8:31775202-31775224 CCTTATCCAGTCCTCCATGATGG - Intronic
1039158717 8:34592945-34592967 CCATTGCCACTCCCCCACCCCGG - Intergenic
1039896569 8:41720698-41720720 CCAGTGCCCCTCCTTCATCAGGG - Intronic
1040723360 8:50351956-50351978 CCTTTTCCTCTCCTCCCTCAAGG - Intronic
1044031102 8:87238524-87238546 ACAGCTCCACTTCTCCATCAGGG + Intronic
1044658177 8:94570089-94570111 CCACTTTCCCTCCTGCATCAGGG + Intergenic
1045381446 8:101631494-101631516 CCATTTCCATTCCTCTGGCAAGG - Intronic
1047463589 8:125091678-125091700 CAGTTTCCACCCCTCCCTCAAGG + Exonic
1048557279 8:135491972-135491994 TCATTTCTATTGCTCCATCAAGG - Intronic
1048969835 8:139639285-139639307 CCATTTCCACTTCTGCAAAATGG - Intronic
1051616823 9:19014574-19014596 CTATTTTCACTCCTCTATCTGGG - Intronic
1056466502 9:86860858-86860880 TCTTTTCCACTCCTTGATCATGG - Intergenic
1058772558 9:108250215-108250237 CCATTACCACTGCTCCATATTGG - Intergenic
1059800936 9:117748944-117748966 CCACTTCCTGCCCTCCATCATGG + Intergenic
1060136499 9:121160626-121160648 CCATTTCTACTCCTCCAGAAAGG + Intronic
1060149799 9:121281368-121281390 CCCTTTCCTCCCCTCCACCAGGG - Intronic
1060195830 9:121622759-121622781 CCATTTGCTCTCCTCCCTCCTGG - Intronic
1061366525 9:130174846-130174868 CCATTTAGAATCCACCATCATGG - Intronic
1061373565 9:130211449-130211471 CCATCTCTACTCCTCCACCCTGG + Intronic
1186667479 X:11732696-11732718 CCGTTTCGTCCCCTCCATCAGGG + Intergenic
1187983976 X:24790448-24790470 ACATTTCCCCTCCTCCACTATGG + Intronic
1189027691 X:37414555-37414577 CCTTTTCCTCTCTTCCCTCATGG - Intronic
1189635587 X:43004986-43005008 CCATTTCTAATTCTGCATCATGG - Intergenic
1189996802 X:46646807-46646829 CCATTTCCCCTCCTTAATCTGGG + Intronic
1192175519 X:68882528-68882550 CCATTTCCTCTCCAGCAGCAGGG + Intergenic
1196054315 X:111338887-111338909 CCATTCCCATTGCTCCACCAAGG + Intronic
1196660109 X:118260472-118260494 CACTTTAAACTCCTCCATCAGGG + Intergenic
1198048216 X:132923686-132923708 TCATTTCCACTTCACCATTAAGG + Intronic
1198392049 X:136186116-136186138 CCATTGCCACTAATCCATCATGG + Intronic
1200258592 X:154599563-154599585 CCCTTTCCATTCCTCCCTCGGGG + Intergenic