ID: 907680133

View in Genome Browser
Species Human (GRCh38)
Location 1:56555285-56555307
Sequence TCCTTACGGTGTCCATGTGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 52}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907680133_907680141 26 Left 907680133 1:56555285-56555307 CCTGCACATGGACACCGTAAGGA 0: 1
1: 0
2: 0
3: 7
4: 52
Right 907680141 1:56555334-56555356 CGTTATTGTTATACTGGTTCTGG 0: 1
1: 0
2: 0
3: 4
4: 65
907680133_907680140 20 Left 907680133 1:56555285-56555307 CCTGCACATGGACACCGTAAGGA 0: 1
1: 0
2: 0
3: 7
4: 52
Right 907680140 1:56555328-56555350 TTATCTCGTTATTGTTATACTGG 0: 1
1: 0
2: 0
3: 12
4: 130
907680133_907680138 -8 Left 907680133 1:56555285-56555307 CCTGCACATGGACACCGTAAGGA 0: 1
1: 0
2: 0
3: 7
4: 52
Right 907680138 1:56555300-56555322 CGTAAGGACCATGGGCTGGCTGG 0: 1
1: 0
2: 0
3: 1
4: 97

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907680133 Original CRISPR TCCTTACGGTGTCCATGTGC AGG (reversed) Intronic
901221306 1:7585528-7585550 TCCTTACAATGCCCATGGGCTGG - Intronic
903059709 1:20661373-20661395 TACTTCCGGTGTGCACGTGCTGG - Exonic
907680133 1:56555285-56555307 TCCTTACGGTGTCCATGTGCAGG - Intronic
916498034 1:165362702-165362724 TCATTAGGGTGTCCCTGTGCTGG + Intergenic
1066193033 10:33073294-33073316 CCCTAAATGTGTCCATGTGCAGG + Intergenic
1076930222 10:133527445-133527467 TCCTGCTGGTGTCCATGTGGAGG + Exonic
1083727298 11:64635264-64635286 TCCTTACGATGTGCAGCTGCAGG + Exonic
1084167841 11:67384595-67384617 TCCTTACAGTATCCTTGGGCCGG - Intronic
1087444678 11:98235108-98235130 TCTTTACTGTGTCCATGAACTGG - Intergenic
1104591511 12:130087763-130087785 TCCTTACGGAGTCAACGTGAGGG - Intergenic
1105610481 13:21965022-21965044 TGCCTATGGTGTCCAAGTGCGGG + Intergenic
1105727235 13:23176560-23176582 TACTTATGGTTTCCATTTGCAGG + Intergenic
1113846296 13:113393755-113393777 TCCTTAGTGTGTACATGTGTGGG - Intergenic
1121313439 14:92947286-92947308 TCCTCAAGGTTTCCATGTGCTGG + Intronic
1128448269 15:67784138-67784160 TCCTTATAGTGTTCATGTGAAGG - Intronic
1133749143 16:8711346-8711368 TCCTTACTTTGTCCTTGTTCAGG - Intronic
1136502216 16:30677584-30677606 TCCTCAAGGTGGGCATGTGCTGG - Intergenic
1137840507 16:51636621-51636643 TTCTTATGGTGTTCATGGGCGGG + Intergenic
1137970324 16:52978271-52978293 TAGTTCCGGGGTCCATGTGCAGG + Intergenic
1138456385 16:57123458-57123480 GCCTTACGGTGAACATGAGCTGG - Exonic
1147934297 17:44002568-44002590 TTCATACTGTGTCCATGTGCTGG - Intronic
1150141319 17:62731458-62731480 TCATCACGGTGGCCAGGTGCTGG + Intronic
1151084229 17:71362687-71362709 TCCTCACGGAGTCCATCTGGGGG + Intergenic
1157437684 18:47684563-47684585 TCCTCCCTTTGTCCATGTGCTGG - Intergenic
1162382325 19:10338934-10338956 TCCTGAAGGTGTCCAGGGGCAGG - Exonic
942563324 2:177243381-177243403 GCCTTACGGTGTGAATGTGCTGG - Intronic
944451711 2:199850763-199850785 TCCTTGCGGCCTCCAAGTGCCGG - Exonic
945426043 2:209703980-209704002 TAATCAGGGTGTCCATGTGCAGG + Intronic
1169335937 20:4757312-4757334 TGCTTTTGGTGTCCATTTGCAGG + Intergenic
1176230106 20:64028239-64028261 TCCTGACGCTGTCCAGATGCAGG - Intronic
1180242287 21:46517837-46517859 TCTTTACGCTGTCCATGTTCAGG - Intronic
950647716 3:14387197-14387219 TCTAGACTGTGTCCATGTGCTGG - Intergenic
954543456 3:51412438-51412460 TGCATACTGTGTCCATGTTCAGG + Exonic
956059207 3:65332866-65332888 TCATTACAGTGTACATGTGGTGG - Intergenic
958545621 3:95545605-95545627 TTCTTACGTTATCCATGTCCAGG - Intergenic
961391045 3:126552572-126552594 TCCATGCTGTGTCCCTGTGCCGG - Intronic
962049753 3:131800613-131800635 TCCTGATGTTGTCCATGTGCAGG + Intronic
966491557 3:180532673-180532695 TCTTTAGGGTGTCGATTTGCTGG - Intergenic
968278480 3:197458443-197458465 GCCTTAGGGTGCCCGTGTGCAGG - Intergenic
968521094 4:1035182-1035204 TCCCTGGGGTGCCCATGTGCAGG - Intergenic
969412187 4:7035565-7035587 TACTAACGGTTTCCATGTGAAGG - Intergenic
969669422 4:8581591-8581613 TGGTGACGGTGTCCATGCGCTGG - Exonic
986135633 5:4975004-4975026 TCCTTCCTGTGCCCAGGTGCTGG - Intergenic
991547942 5:67804460-67804482 TCTTTACTGTTTCCATGTGATGG + Intergenic
992694550 5:79273215-79273237 TTCTTATGGTGTCCATCTGCTGG + Intronic
998885626 5:146691060-146691082 TCCTAAGGTTGGCCATGTGCTGG - Intronic
1001572487 5:172739335-172739357 TCCTTCCTGTGTCCTGGTGCTGG + Intergenic
1003926743 6:10883676-10883698 TACTGAGGGTCTCCATGTGCCGG - Intronic
1033537145 7:142322443-142322465 TCCTTACAGTTTCCATGGCCTGG + Intergenic
1038821497 8:30956218-30956240 TCCTTACAATGTCCTTGTGAAGG + Intergenic
1039473917 8:37829435-37829457 GTCTTAGGGTGTCCATGGGCCGG - Intronic
1042031836 8:64484552-64484574 TGCTTACGGTGTGTATTTGCTGG - Intergenic
1042466877 8:69138348-69138370 TCCTTCTGTTGTCCATATGCTGG + Intergenic
1048272959 8:133044026-133044048 TCCTCACGGTGTCCTTGGGAGGG + Intronic
1049828139 8:144683859-144683881 TGCTTCCGGGGTGCATGTGCTGG - Intergenic
1052100516 9:24440729-24440751 GGCTTAGGGTGTACATGTGCAGG + Intergenic
1056630325 9:88288085-88288107 TCCTTACTGTTGCCTTGTGCTGG - Intergenic
1059655066 9:116350143-116350165 TGCTTACTCTGTCCATATGCAGG - Intronic
1062273250 9:135719320-135719342 TCCTGACGGTGTCCCCGAGCTGG + Intronic
1190413059 X:50156154-50156176 TCCCTATGGTGTCGGTGTGCAGG + Intergenic