ID: 907680904

View in Genome Browser
Species Human (GRCh38)
Location 1:56562363-56562385
Sequence GCATAAAGAATACACGGGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 77}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907680897_907680904 26 Left 907680897 1:56562314-56562336 CCTATGTGATCGGGATTGTAGTA 0: 1
1: 0
2: 0
3: 3
4: 48
Right 907680904 1:56562363-56562385 GCATAAAGAATACACGGGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 77
907680898_907680904 -8 Left 907680898 1:56562348-56562370 CCCTGTAGACTCACTGCATAAAG No data
Right 907680904 1:56562363-56562385 GCATAAAGAATACACGGGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 77
907680899_907680904 -9 Left 907680899 1:56562349-56562371 CCTGTAGACTCACTGCATAAAGA No data
Right 907680904 1:56562363-56562385 GCATAAAGAATACACGGGGGAGG 0: 1
1: 0
2: 0
3: 6
4: 77

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907680904 Original CRISPR GCATAAAGAATACACGGGGG AGG Intronic
907680904 1:56562363-56562385 GCATAAAGAATACACGGGGGAGG + Intronic
907848064 1:58227796-58227818 GCATGCAGAATACACAGGAGAGG - Intronic
907947023 1:59145229-59145251 TCATAAAGAAGACAGAGGGGAGG - Intergenic
911848832 1:102788442-102788464 GCATAGAAAATAGACTGGGGAGG - Intergenic
918691489 1:187485982-187486004 GCACAAAGAGTAAATGGGGGAGG - Intergenic
1067491526 10:46709784-46709806 GCATAAATATTACACAGGTGTGG - Intergenic
1067603136 10:47630594-47630616 GCATAAATATTACACAGGTGTGG + Intergenic
1067989078 10:51189191-51189213 CCATAAAGAATATACGGGCCTGG - Intronic
1073447263 10:103589175-103589197 GCAGAAAGCATACATGGGGAGGG + Intronic
1073893836 10:108131117-108131139 GCTTACAGAATTCCCGGGGGAGG - Intergenic
1083468295 11:62864092-62864114 ACAAAAAGAATGCACGGGTGTGG - Intronic
1084195714 11:67522860-67522882 GCCTAAAGAGTTCACGGGTGAGG - Intronic
1087268122 11:96083157-96083179 GGATAAAGAACACACTGGAGGGG - Intronic
1088153402 11:106775698-106775720 GAGTTAAGAAAACACGGGGGCGG - Intronic
1101196340 12:102386654-102386676 GCATATAGATTAGACTGGGGTGG + Intergenic
1101692031 12:107091920-107091942 GGATAAAGAATACAAGGGTAGGG - Intronic
1106190600 13:27449450-27449472 GCATAAAGAAGAAACTGGAGAGG - Intronic
1109903962 13:68813477-68813499 GCAGAAAGAACACTCGGGGTGGG - Intergenic
1114277236 14:21157920-21157942 GCAGGAAGCATACACTGGGGTGG + Intergenic
1125326237 15:38538481-38538503 GCAAAAAGAGAAGACGGGGGTGG - Intronic
1126347837 15:47715878-47715900 GCATAAAGATTGCAAGGGGGTGG - Intronic
1126981253 15:54246259-54246281 ACATATAGACTACACTGGGGAGG - Intronic
1127297089 15:57618211-57618233 ACAAAAAGAATACAGGTGGGGGG - Intronic
1131323138 15:91415760-91415782 GCAAAAAGAATACAACGAGGAGG - Intergenic
1135298088 16:21300901-21300923 GCATGAGAAATACACGGAGGTGG + Intronic
1142336900 16:89495228-89495250 GCAGAAAGAATGCAGGGGGCTGG - Intronic
1143161460 17:4874495-4874517 GCAGAAGGAAGACATGGGGGAGG + Intronic
1143903936 17:10195296-10195318 GCAGGAAGCATACACGGGGGAGG - Intronic
1203170619 17_GL000205v2_random:145330-145352 GCTTACAGAACACACGGGCGAGG + Intergenic
1153947322 18:10029381-10029403 GGAAAAAGAAGACACTGGGGAGG + Intergenic
1154429814 18:14299875-14299897 GCAGAAAGAAAATACGGGGTTGG + Intergenic
1156023906 18:32630241-32630263 GCAAAAAGAACATTCGGGGGCGG - Intergenic
1165114764 19:33522145-33522167 GAATAAAGAAACCACGTGGGAGG + Intergenic
1166193883 19:41193833-41193855 GCACAAAGAAGAAAAGGGGGAGG + Intronic
1166543537 19:43621032-43621054 GCATGAAGAGTACATGGGGCTGG + Intergenic
1167195560 19:48025777-48025799 GCACAAGGAAGACACGGAGGCGG - Intergenic
926575975 2:14581888-14581910 GCCAAAAGAAAACACAGGGGGGG - Intergenic
928689322 2:33782801-33782823 GCATAAAGAATATAGTGGAGGGG + Intergenic
928873763 2:36012758-36012780 GCCTGAAGGATACAGGGGGGAGG - Intergenic
932775534 2:74526074-74526096 GGATAAAGAATATAGGGGGTGGG + Intronic
933548512 2:83743951-83743973 CCCTGGAGAATACACGGGGGTGG - Intergenic
938257120 2:129868207-129868229 GCATTACAACTACACGGGGGTGG + Intergenic
940068297 2:149654329-149654351 TCAAAAAGAATTCATGGGGGAGG - Intergenic
940991801 2:160104780-160104802 TCATAAAGAATATGTGGGGGTGG + Intronic
944639313 2:201706945-201706967 GCATAAAGCATAAACAGCGGTGG + Exonic
945720448 2:213411926-213411948 CTATAAAGAATACAAGGGGAAGG + Intronic
948314263 2:237015111-237015133 GGATAAAGAATATGCGGGGCCGG - Intergenic
1173824893 20:46041912-46041934 GCACAGAGAATGCCCGGGGGGGG + Intronic
1178316362 21:31569842-31569864 GCATATAGAAGACACGGGTGGGG - Intergenic
1180671646 22:17558287-17558309 GCATCCAGAATCCACGGAGGCGG + Intergenic
1184257434 22:43295229-43295251 CCAGAAAGACTACACGGAGGAGG - Intronic
953836960 3:46354942-46354964 GGATAAAGTATACAGGTGGGTGG + Intronic
959766287 3:110033342-110033364 GCATTAAGAAAACACAGGGACGG - Intergenic
963844391 3:150140672-150140694 GCAGAAAGAACACTCGGTGGGGG + Intergenic
964600494 3:158495584-158495606 GCATAAACAATTCACAGTGGAGG - Intronic
974993586 4:69125134-69125156 GCATTGAGAATACATGAGGGTGG + Intronic
975256521 4:72242551-72242573 GCATTAAGCATACAAGGGTGAGG + Intergenic
977037895 4:91978197-91978219 GAATAAATAATACTCGAGGGAGG + Intergenic
978218555 4:106239493-106239515 GGATAAAGAATACAAGGGATAGG + Intronic
981714352 4:147738063-147738085 GGATAAAGAATACAGAGAGGAGG + Intronic
990738826 5:58891716-58891738 GCTCAAAGAACACACAGGGGTGG - Intergenic
991982112 5:72243037-72243059 GGATACAGAATTCACTGGGGCGG - Intronic
995067740 5:107880929-107880951 TAATATATAATACACGGGGGTGG + Intronic
997516280 5:134492094-134492116 GCAGAAAGAAGACACAGGGCAGG - Intergenic
999226453 5:150028862-150028884 AAATAAAGAAGACACTGGGGAGG - Intronic
1003313279 6:4987490-4987512 GCATAAAGGAGACATGGGAGGGG + Intergenic
1005216976 6:23541468-23541490 GCATGAAGAATACAGGAGGCAGG - Intergenic
1005562920 6:27059794-27059816 GCAGAAAGAACACTCGGGGGGGG + Intergenic
1012327467 6:97940098-97940120 GCATATACATTACTCGGGGGAGG + Intergenic
1015385640 6:132619961-132619983 GCAGAGAGAATACAAGGTGGAGG + Intronic
1030102449 7:105958225-105958247 CCACAAAGAAGACACGGGGAGGG + Intronic
1032679553 7:134167857-134167879 GGATAAAGAAAACAGGGAGGGGG - Intronic
1036599680 8:10248824-10248846 GCGTAGAGAATACAAGGGGGCGG + Intronic
1048582295 8:135739701-135739723 GCATATAGAAAACAAGGTGGGGG - Intergenic
1051094028 9:13444482-13444504 CCATAAAAAAAACATGGGGGAGG - Intergenic
1052790312 9:32869491-32869513 GTAAACAGAATACACGGGGCTGG - Intergenic
1054986612 9:71269028-71269050 GCATAGCAAGTACACGGGGGCGG + Intronic
1061209879 9:129184903-129184925 GCATTAAGAATTCACTAGGGTGG - Intergenic
1203435514 Un_GL000195v1:133346-133368 GCTTACAGAACACACGGGCGAGG - Intergenic
1191914456 X:66186724-66186746 GCACAAAGAACACCTGGGGGAGG - Intronic
1196964612 X:121042288-121042310 GGATAAAGAATACACAGGCACGG - Intergenic
1197977775 X:132183473-132183495 GGATATAGAATACACGATGGAGG + Intergenic
1198691502 X:139289811-139289833 AGATAAAGAATACAAGGAGGTGG + Intergenic
1198737121 X:139798974-139798996 GCAAAAAAAATACATGGGGGGGG + Intronic