ID: 907684224 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:56594303-56594325 |
| Sequence | CTGAATAACTAGAAGGATGG AGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | No data | |||
| Summary | No data |
Found 1 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 907684220_907684224 | -9 | Left | 907684220 | 1:56594289-56594311 | CCAAGGGTTTTAGCCTGAATAAC | 0: 1 1: 0 2: 6 3: 35 4: 201 |
||
| Right | 907684224 | 1:56594303-56594325 | CTGAATAACTAGAAGGATGGAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 907684224 | Original CRISPR | CTGAATAACTAGAAGGATGG AGG | Intronic | ||
| No off target data available for this crispr | |||||