ID: 907684224

View in Genome Browser
Species Human (GRCh38)
Location 1:56594303-56594325
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907684220_907684224 -9 Left 907684220 1:56594289-56594311 CCAAGGGTTTTAGCCTGAATAAC 0: 1
1: 0
2: 6
3: 35
4: 201
Right 907684224 1:56594303-56594325 CTGAATAACTAGAAGGATGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
No off target data available for this crispr