ID: 907689746

View in Genome Browser
Species Human (GRCh38)
Location 1:56651025-56651047
Sequence CTAGCACACAAGTCAAGCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 118
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 105}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907689746_907689750 8 Left 907689746 1:56651025-56651047 CCCTTGCTTGACTTGTGTGCTAG 0: 1
1: 0
2: 0
3: 12
4: 105
Right 907689750 1:56651056-56651078 CCCTGAACAATTTAACTCCCTGG No data
907689746_907689752 9 Left 907689746 1:56651025-56651047 CCCTTGCTTGACTTGTGTGCTAG 0: 1
1: 0
2: 0
3: 12
4: 105
Right 907689752 1:56651057-56651079 CCTGAACAATTTAACTCCCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907689746 Original CRISPR CTAGCACACAAGTCAAGCAA GGG (reversed) Intronic
907689746 1:56651025-56651047 CTAGCACACAAGTCAAGCAAGGG - Intronic
910573044 1:88727608-88727630 GTAGCCCACAGGTCAAGAAAAGG - Intronic
914888908 1:151605575-151605597 CTAGAATACAAGTCTAGGAAAGG - Intergenic
915212601 1:154321818-154321840 TGAGCACAGAAGACAAGCAAGGG - Intronic
918079489 1:181194863-181194885 AGAGCACACAAGTCAAGAACTGG + Intergenic
1065609623 10:27459408-27459430 TTAGTACACAAGTCTACCAAAGG + Intergenic
1067208571 10:44239863-44239885 CTGAGACACCAGTCAAGCAATGG + Intergenic
1067570472 10:47367861-47367883 CTGGCACACAGGGCAGGCAAGGG + Exonic
1073183787 10:101603006-101603028 CTAGCTCTCAAGGCAAGCAGGGG + Intronic
1075607536 10:123824217-123824239 TTAGAACACAAGCCAGGCAATGG - Intronic
1076907427 10:133370202-133370224 CTAGAACAGAAGTCACGCAGAGG + Intronic
1077367949 11:2168771-2168793 CTAGCACAAAAGTCAAGGGCAGG - Intronic
1081683456 11:45025015-45025037 CTCACTCACAAGTCTAGCAATGG - Intergenic
1085128849 11:74020469-74020491 TTAGCACTGAAGTAAAGCAAAGG - Intronic
1086381167 11:86255880-86255902 CTAGCAAACAAGACAAGGCAAGG + Intronic
1087849590 11:103012645-103012667 CCATCACACAAGTCACACAATGG - Intergenic
1091781925 12:3219318-3219340 CTAGCACAACACTCAAGGAAGGG + Intronic
1093592502 12:20919970-20919992 CAAGAACACAAATCAAGGAAAGG - Intergenic
1093822161 12:23634493-23634515 CTAGCACAAAACTCTAGGAAGGG + Intronic
1096606348 12:52769122-52769144 CAGGCACACAATTCAGGCAAAGG + Intronic
1096951009 12:55471306-55471328 ATAGTACAGAAGTAAAGCAAAGG + Intergenic
1097478878 12:60095428-60095450 CAAACACACAAATCAAGAAAGGG - Intergenic
1098701371 12:73631986-73632008 CTACCACACAAATCAAGAAATGG + Intergenic
1098802151 12:74974814-74974836 CTAGAACACAAGGCATGCAAAGG + Intergenic
1098987084 12:77024254-77024276 CTAACACACAGGTCAAGAAAGGG - Intronic
1109040711 13:57332401-57332423 CTAGCCCACAGGTCAAGAATTGG + Intergenic
1110613260 13:77512808-77512830 CTGGCACAAAAGACAAGTAAAGG - Intergenic
1112135977 13:96578129-96578151 CTCCCACACAAGTCCAGCAATGG + Intronic
1114774233 14:25462558-25462580 CTACCACACAAGGCAATTAATGG + Intergenic
1118167145 14:63347768-63347790 CCAGCACCCCAGGCAAGCAAGGG + Intergenic
1119874801 14:78049624-78049646 CTAGCACTGAACTCAACCAATGG - Intergenic
1121861927 14:97326526-97326548 CCAGCATGCAAGTGAAGCAATGG - Intergenic
1128023271 15:64412123-64412145 CTAACATACAACTAAAGCAAAGG - Intronic
1133280765 16:4663934-4663956 CAAACACAAAAGGCAAGCAAGGG - Intronic
1141018101 16:80469018-80469040 CTAAGAAACAAGTCAATCAATGG + Intergenic
1146910388 17:36644837-36644859 CTAGTTCACAAGTAGAGCAAGGG - Intergenic
1147549169 17:41426618-41426640 CTGGAAAACAAGTCAACCAATGG + Intergenic
1150430802 17:65115416-65115438 CTAGCACACCAGTCCAGCCTTGG - Intergenic
1152433672 17:80262727-80262749 CTCCCACACAGGTCAAGCCAGGG + Intronic
1152433956 17:80263979-80264001 CTCCCACACAGGTCAAGCCAGGG + Intronic
1156733147 18:40220694-40220716 CTCACAGACAAATCAAGCAAGGG + Intergenic
1158450768 18:57562751-57562773 CAAACACACAATTTAAGCAAGGG + Intronic
1167802912 19:51756959-51756981 CTAGCACACTACTCCAGCACAGG + Intronic
928676064 2:33653021-33653043 CTGGCACAGAAGTGAGGCAAAGG + Intergenic
929774385 2:44919336-44919358 CCAGAACACAAGTGAAGGAATGG - Intergenic
930698750 2:54438505-54438527 GTAACAAACAAGTCAGGCAAAGG - Intergenic
930854212 2:55994993-55995015 CTACCACCCAGGTCAAGAAAGGG + Intergenic
930909582 2:56615760-56615782 CTAGCAGTCAAGGCAAGCCAAGG + Intergenic
933283137 2:80354836-80354858 CTGGCATACAACTGAAGCAAGGG - Intronic
935348511 2:102132366-102132388 ATAGCACAAAAGTCACGCAAGGG + Intronic
937593325 2:123641808-123641830 GTATCACACAAGTGAAGCCAAGG - Intergenic
938015355 2:127862666-127862688 CTCCCACACAAGTCCAGCAATGG - Exonic
941307981 2:163894006-163894028 CTTCCACACAAGTCAAGGACTGG + Intergenic
943246983 2:185467291-185467313 CAAGTACACAAGTGAAGGAAGGG - Intergenic
943551104 2:189340230-189340252 GTAGCACACTACTCCAGCAATGG - Intergenic
944983172 2:205145670-205145692 CTAGCATACACTTAAAGCAATGG - Intronic
946381344 2:219351112-219351134 CCAGCAGACAATCCAAGCAAAGG + Intergenic
946605346 2:221398592-221398614 GTAGCAGAAAAGTCAAGGAAAGG + Intergenic
946891130 2:224278198-224278220 CTAGACCACAAATCCAGCAAAGG - Intergenic
946931002 2:224671109-224671131 CTTTCACACAACTCTAGCAATGG - Intergenic
947428368 2:230004212-230004234 CAAGCACAAAAGCCAATCAAGGG - Intronic
1169724200 20:8711742-8711764 GTGGCTCACAAGTCAAGCACGGG - Intronic
1170231922 20:14058108-14058130 CCACCACCCAAGTCAAGAAAAGG - Intronic
1178404779 21:32315260-32315282 TTAACACAAAAGTTAAGCAAAGG - Intronic
958044937 3:88272432-88272454 CTAGTAAATAAGTTAAGCAATGG - Intergenic
959364148 3:105435702-105435724 CTAATACACAAGTGAAGCAATGG - Intronic
962311603 3:134330967-134330989 CTAGGACAAAAGTCAGGCTAGGG - Intergenic
963405827 3:144862640-144862662 ATAGCACAAAAGACAAGGAAAGG + Intergenic
969888961 4:10242045-10242067 ACAGCCCACAAGTCAAGCAATGG - Intergenic
970717387 4:18942076-18942098 CAAGCATACAAGTCACACAAGGG - Intergenic
974524691 4:63034518-63034540 CTAGCAAACAATTCATGCGAAGG - Intergenic
974725118 4:65788681-65788703 ATAGAACAAAAGTCAAACAAAGG - Intergenic
976844618 4:89473761-89473783 CTGGCACAAAAGTGAAGCCAGGG - Intergenic
977983109 4:103349359-103349381 CTAGCACTCAAGACACTCAAAGG - Intergenic
981688398 4:147480670-147480692 GGAGCACGCAAGCCAAGCAAAGG + Intergenic
982088790 4:151862516-151862538 TTAGCACTCAACTCCAGCAATGG - Intergenic
982392901 4:154884952-154884974 CCAGTACACAAGTCAAGAATTGG - Intergenic
982675405 4:158369341-158369363 CTATCACACAAATAAAACAATGG + Intronic
984517498 4:180758368-180758390 CTATCACACAGCTCAAGCTAAGG + Intergenic
1001658204 5:173370303-173370325 TTAGCACAAAATTAAAGCAAAGG - Intergenic
1002923869 6:1593736-1593758 AAAGAACACCAGTCAAGCAAGGG - Intergenic
1003039620 6:2675255-2675277 ATAGCACACAATTCAAGAGAAGG - Intronic
1006602235 6:35233676-35233698 TTATCACACTAGTCAACCAAGGG - Intronic
1009318152 6:62249706-62249728 ATAGAACACAAGTCATGCATTGG - Intronic
1009963959 6:70557929-70557951 CTAGAACAGAAGTTAAGAAAAGG - Intronic
1010136310 6:72557812-72557834 CTGCCAAAGAAGTCAAGCAAAGG + Intergenic
1011710204 6:90045278-90045300 CTTGCACACAAGCCAAGCAGTGG - Intronic
1016178455 6:141110797-141110819 CTTGCACACAAGGTCAGCAATGG - Intergenic
1017151351 6:151283263-151283285 CTAGGGCAGAAATCAAGCAATGG + Intronic
1018233390 6:161698331-161698353 ATACTATACAAGTCAAGCAAAGG + Intronic
1020663521 7:11010406-11010428 ATAACACACAAGATAAGCAAAGG - Intronic
1027469819 7:78559301-78559323 TTAATACACAAGTCAACCAAGGG - Intronic
1029727938 7:102420174-102420196 CTAGCACACAAGGCCAGGCACGG - Intronic
1031754329 7:125618675-125618697 CTAACACTCCAGTCAAGGAAGGG + Intergenic
1033201449 7:139375422-139375444 CTTACACACCAGTCAAACAAAGG - Intronic
1036725283 8:11215113-11215135 CCAGCACACAGATCAAGAAAAGG - Intergenic
1037579996 8:20239419-20239441 CTGGAAAACCAGTCAAGCAAAGG + Intergenic
1039375907 8:37033809-37033831 CTTGTACCCAAGTCAAGAAATGG + Intergenic
1042510443 8:69605650-69605672 CTAGCATACATTTCAATCAAGGG - Intronic
1043948720 8:86283594-86283616 CTAGCACACAAGGCATGAATAGG - Intronic
1044131535 8:88529848-88529870 CTAGTACATAACTCAAGAAAAGG - Intergenic
1045698650 8:104840345-104840367 TTTCCACACAAGACAAGCAATGG - Intronic
1046184911 8:110699977-110699999 CTAACAAACCAGTCAACCAATGG + Intergenic
1048426477 8:134328475-134328497 TTAGCACCCAAGCCAAGCAGAGG + Intergenic
1049953916 9:673849-673871 CAAACACACAAGGCTAGCAAGGG + Intronic
1050042202 9:1507795-1507817 ATAGCACACAAGTCAGGAAAGGG - Intergenic
1051081392 9:13298452-13298474 ATAGCAAATAAGTCAAACAAAGG + Intergenic
1052278456 9:26705444-26705466 CTATCACACAAGACAAGAAAAGG + Intergenic
1055329844 9:75172453-75172475 CTAGCACACATGTCAAAAAGTGG + Intergenic
1056271775 9:84954367-84954389 CTAACACGCAAGTCCTGCAAGGG - Intronic
1056440467 9:86615974-86615996 CTAACACATAAGTCATACAAAGG - Intergenic
1056634833 9:88322934-88322956 ACAGCACACAAGTGAAGGAATGG + Intergenic
1058974037 9:110109574-110109596 CTAGAAGACATGTCAAGCTATGG - Intronic
1058975753 9:110124189-110124211 CAAGCACACGAGTCAAGGAAGGG - Intronic
1188497227 X:30793418-30793440 TTGACACACAAGTCAAGGAAAGG - Intergenic
1192634083 X:72802000-72802022 AAAGCACACAAGACAAGGAATGG + Intronic
1192647627 X:72918801-72918823 AAAGCACACAAGACAAGGAATGG - Intronic
1194373007 X:93097812-93097834 CCACCACACAGGTCAAGAAAAGG - Intergenic