ID: 907691315

View in Genome Browser
Species Human (GRCh38)
Location 1:56669507-56669529
Sequence CTGCCTACTGGGATCTACCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 101
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 92}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907691315 Original CRISPR CTGCCTACTGGGATCTACCA TGG Intronic
900537876 1:3187703-3187725 CTGCCTGCTGGGAGCTGCCAAGG - Intronic
900569328 1:3350658-3350680 CTGCCTTCTGGGTGCTCCCAGGG - Intronic
902734168 1:18389209-18389231 CTGCCTTCGGGGAGCTTCCAGGG - Intergenic
903974648 1:27141499-27141521 CAGCCTACTGGGATCTTCCCAGG + Intronic
906482090 1:46205810-46205832 CTGCCTACTGGGTTGCACCCAGG + Intronic
907691315 1:56669507-56669529 CTGCCTACTGGGATCTACCATGG + Intronic
909341441 1:74536004-74536026 CTGATTACTAGGAGCTACCATGG - Intronic
920342707 1:205285356-205285378 CTGCCTAGTGGAGTCTACCCGGG - Intergenic
921059569 1:211572548-211572570 CTACCTACTGTGATTTTCCAAGG + Exonic
923752709 1:236761043-236761065 TTGCCCGTTGGGATCTACCAGGG - Exonic
1067356712 10:45535230-45535252 CTGACTATTGTGATCTCCCAGGG - Exonic
1068688613 10:59893909-59893931 CTGCTTACTGCGATCTTCAAGGG + Intronic
1071403282 10:85299824-85299846 CTGCCTACTGACATCTTCCCAGG - Intergenic
1077584491 11:3440341-3440363 CTGCCTCCTGGGAGGTACTAAGG + Intergenic
1077700250 11:4434760-4434782 CTGCCTACTGAGATCAGGCAAGG + Intergenic
1078753755 11:14189403-14189425 CTGCCATCTGGGTACTACCAGGG + Intronic
1084241393 11:67822993-67823015 CTGCCTCCTGGGAGGTACTAAGG + Intergenic
1084645225 11:70452920-70452942 CTGCCCACTGTGCTCTTCCAGGG + Intergenic
1089341824 11:117763330-117763352 CTGCCCACTGGGATCACACAGGG - Intronic
1089341896 11:117763694-117763716 CTGCCCACTGGGATCACACAGGG + Intronic
1090787012 11:130058373-130058395 CAGCCAACTGGGACCTCCCAAGG - Intergenic
1092411640 12:8257628-8257650 CTGCCTCCTGGGAGGTACTAAGG + Intergenic
1096637778 12:52972008-52972030 TTGCCCACAGGGGTCTACCATGG - Intergenic
1099201997 12:79689647-79689669 CTTCCTCCTGGGAGCTACCCGGG - Intronic
1099625378 12:85066099-85066121 ATGTGTACTGGGAGCTACCAAGG + Intronic
1099848180 12:88056678-88056700 CTGACTACTGGGACAAACCAGGG - Intronic
1100200195 12:92289897-92289919 CTGCTTACTGGCCTCTAACAGGG + Intergenic
1112188482 13:97151131-97151153 CAGCTTTCTGGGATCTGCCAAGG - Intergenic
1113633360 13:111903170-111903192 CTGCTTTCTGGAATCTGCCATGG - Intergenic
1113633390 13:111903442-111903464 CTGCTTTCTGGAATCTGCCACGG - Intergenic
1114428957 14:22644155-22644177 CTGCCACCTAGGATCTTCCACGG + Intergenic
1118330026 14:64807848-64807870 CATCCTACTGGGACCCACCATGG + Intronic
1120747143 14:88162816-88162838 CTGCCTTCTAGGATCTCCCATGG + Intergenic
1121938460 14:98043801-98043823 CAGCCTGCTGGAATCTCCCAAGG + Intergenic
1128556853 15:68637698-68637720 CTGCCCCATGGGAGCTACCAGGG + Intronic
1132829914 16:1922987-1923009 CTGCCTAGCCGGATCTCCCAAGG + Intergenic
1133352885 16:5113929-5113951 CTGCCTCCTGGGAGGTACTAAGG + Intergenic
1137919613 16:52474276-52474298 CTGCCTTTTGGGATCCACCCAGG + Intronic
1141275696 16:82585902-82585924 CTGGCTGCTGGGACCTCCCAGGG + Intergenic
1145286010 17:21506360-21506382 CTGCCTGCTGTGATCTACCGCGG - Intergenic
1145391597 17:22459944-22459966 CTGCCTGCTGCGATCCATCACGG + Intergenic
1147623177 17:41881756-41881778 CTGGCTACACAGATCTACCAAGG + Intronic
1150976935 17:70098103-70098125 CTGCATCCTGGGATCTAAAATGG - Intronic
1151579911 17:74972066-74972088 CTGCCCACGGGCATCGACCAGGG + Intronic
1156630031 18:38956203-38956225 CTGCCTCCATGGATCTACCTTGG + Intergenic
1160637545 19:91007-91029 CTGACTACTGGGCGCTACCTGGG + Intergenic
1166295869 19:41889064-41889086 CTGCGCACTGAGATCTACCCTGG - Intronic
928230720 2:29496744-29496766 GTGGCTACTGGGGTCTTCCATGG - Intronic
928608634 2:32968999-32969021 CTGCCTCCTGGGCTCAAGCAGGG + Intronic
928621389 2:33091806-33091828 CTGCCTCCTGAGCTCTTCCAGGG + Intronic
929973010 2:46600166-46600188 CTACCTACAGGGATCTGCTAAGG - Intronic
931693544 2:64855298-64855320 CTGCCTACTTGGACCTCCCTGGG + Intergenic
933232620 2:79826563-79826585 ATGTCTTCTGGGATCTAGCAAGG + Intronic
934041541 2:88131185-88131207 CTGCTTTCTGGGATCTACGGAGG + Intergenic
935566942 2:104619039-104619061 TTGCCTCCTGGGCTCTGCCAGGG + Intergenic
935815436 2:106842748-106842770 CTGCCTACTGGCATCAGCTATGG + Intronic
940848295 2:158663968-158663990 CTGCCCACTGGGGCCCACCATGG + Intronic
943206409 2:184902882-184902904 CTGCCTACTAGGCTCAGCCAAGG + Intronic
1170696683 20:18665369-18665391 CTGCCTCCTGGGATCAGCCCCGG + Intronic
1171320479 20:24239470-24239492 CTTTCCACTGGCATCTACCAAGG + Intergenic
1176063547 20:63182643-63182665 CTGCCTTCTGGGATCTGGCCTGG - Intergenic
1182104688 22:27681045-27681067 CTTCATACTGGGTTCTACCTGGG + Intergenic
1182475165 22:30573224-30573246 CTGCCTTCTTGGATCTGCCTGGG - Intronic
1182489516 22:30661818-30661840 CTGACTACTGGGATCCATAAGGG - Intronic
1183903103 22:41021159-41021181 CTGGCTCCTGGCATCTTCCAGGG + Intergenic
953415203 3:42711797-42711819 CTGCCTACTGGCTTTTAACATGG - Intronic
957056863 3:75449900-75449922 CTGCCTCCTGGGAGGTACTAAGG + Intergenic
957594119 3:82239020-82239042 CTGAATACTGGTATCTGCCAAGG + Intergenic
961296608 3:125889816-125889838 CTGCCTCCTGGGAGGTACTAAGG - Intergenic
962171333 3:133104647-133104669 CTGCCTCCTGGGATCCATCAGGG + Intronic
963710232 3:148738930-148738952 CTGCCTCCTGGAACATACCAGGG + Intronic
969754328 4:9138449-9138471 CTGCCTCCTGGGAGGTACAAAGG - Intergenic
971214177 4:24648274-24648296 ATCCCTACAGGGATCTTCCAAGG - Intergenic
975725909 4:77291415-77291437 CTGCCTCTTGGCATCCACCATGG + Intronic
981883017 4:149638712-149638734 CTGGCTAATTGGATCTACCTAGG - Intergenic
984370158 4:178853474-178853496 CTGCCTTCAGGGATCTCTCAGGG + Intergenic
987040243 5:14055349-14055371 CTGCATACTGGGTACTCCCAGGG - Intergenic
993263208 5:85688367-85688389 CTTCTGATTGGGATCTACCAGGG + Intergenic
1000500134 5:162037797-162037819 CTGCCTACTGGTACCATCCAAGG + Intergenic
1003486023 6:6580180-6580202 TGGCCTCCTGGGATCCACCATGG - Intergenic
1013720115 6:113015529-113015551 CTGCCTCCTGGGTTCAAGCACGG + Intergenic
1015901041 6:138067258-138067280 CTTCCTAATGGGATCTAGAATGG - Intergenic
1017558896 6:155605624-155605646 CTACCTACAGGGTTGTACCAGGG + Intergenic
1018711344 6:166500055-166500077 CTGCCTGCTGGCTTCCACCATGG + Intronic
1024122378 7:46257621-46257643 CTGCATACTGGGATCTTCTTAGG + Intergenic
1031904680 7:127447352-127447374 CTGCCTACTGGATTCCCCCATGG + Intergenic
1038421671 8:27437713-27437735 CTCCATACTGGGACCAACCAGGG + Intronic
1044906544 8:97010036-97010058 CTTCCTACTGGTATCTACTATGG - Intronic
1045317514 8:101056166-101056188 CTGAGTACTGGGAGTTACCAAGG + Intergenic
1046906688 8:119581426-119581448 CTCCCTGTTGGGCTCTACCAAGG + Intronic
1048314790 8:133353975-133353997 CTGCCAACTGGGACATACTAGGG + Intergenic
1048982886 8:139712556-139712578 CTTCCCACTGGTATCTACAAGGG + Intergenic
1049163777 8:141114030-141114052 CTGCCTTCTGGGACCTCCCAAGG - Intergenic
1052596264 9:30562054-30562076 GTGTCTTCTGGGCTCTACCATGG + Intergenic
1057082079 9:92180629-92180651 CTGCGTACTCGGAGCTCCCAAGG - Intergenic
1060997719 9:127884576-127884598 CAGCCTGCTGGGATCTCCCAGGG - Intergenic
1187607850 X:20905804-20905826 CTGTCTTCTGGCATCTCCCAGGG - Intergenic
1197408368 X:126084673-126084695 CTGTCTACTGGGATCAACTTGGG + Intergenic
1197421254 X:126238438-126238460 CTGCCTCCTGCCACCTACCATGG - Intergenic
1198632608 X:138657666-138657688 CTGACTACTGGGCTCTATGAAGG + Intronic
1198830218 X:140742519-140742541 TTGTCTACTTGGATCTACCTGGG - Intergenic