ID: 907692892

View in Genome Browser
Species Human (GRCh38)
Location 1:56688207-56688229
Sequence ACCCCTAACCACAATGGGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907692892_907692902 2 Left 907692892 1:56688207-56688229 CCTACCCCATTGTGGTTAGGGGT No data
Right 907692902 1:56688232-56688254 GGGACAAAGGGAAATTTTATTGG No data
907692892_907692901 -10 Left 907692892 1:56688207-56688229 CCTACCCCATTGTGGTTAGGGGT No data
Right 907692901 1:56688220-56688242 GGTTAGGGGTGGGGGACAAAGGG 0: 1
1: 0
2: 5
3: 90
4: 830

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907692892 Original CRISPR ACCCCTAACCACAATGGGGT AGG (reversed) Intronic
No off target data available for this crispr