ID: 907692901

View in Genome Browser
Species Human (GRCh38)
Location 1:56688220-56688242
Sequence GGTTAGGGGTGGGGGACAAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 926
Summary {0: 1, 1: 0, 2: 5, 3: 90, 4: 830}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907692892_907692901 -10 Left 907692892 1:56688207-56688229 CCTACCCCATTGTGGTTAGGGGT No data
Right 907692901 1:56688220-56688242 GGTTAGGGGTGGGGGACAAAGGG 0: 1
1: 0
2: 5
3: 90
4: 830
907692886_907692901 -2 Left 907692886 1:56688199-56688221 CCTTTGTCCCTACCCCATTGTGG No data
Right 907692901 1:56688220-56688242 GGTTAGGGGTGGGGGACAAAGGG 0: 1
1: 0
2: 5
3: 90
4: 830
907692884_907692901 16 Left 907692884 1:56688181-56688203 CCTTCTGAAATTTGTTTCCCTTT 0: 1
1: 0
2: 1
3: 81
4: 721
Right 907692901 1:56688220-56688242 GGTTAGGGGTGGGGGACAAAGGG 0: 1
1: 0
2: 5
3: 90
4: 830
907692885_907692901 -1 Left 907692885 1:56688198-56688220 CCCTTTGTCCCTACCCCATTGTG No data
Right 907692901 1:56688220-56688242 GGTTAGGGGTGGGGGACAAAGGG 0: 1
1: 0
2: 5
3: 90
4: 830
907692890_907692901 -9 Left 907692890 1:56688206-56688228 CCCTACCCCATTGTGGTTAGGGG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 907692901 1:56688220-56688242 GGTTAGGGGTGGGGGACAAAGGG 0: 1
1: 0
2: 5
3: 90
4: 830

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907692901 Original CRISPR GGTTAGGGGTGGGGGACAAA GGG Intronic
900715407 1:4140741-4140763 GGTTTGGGGTGGGAGATACAGGG + Intergenic
901789478 1:11646841-11646863 GCTTAGGGGTGGGAGACTAAGGG - Intergenic
902286532 1:15411279-15411301 GGGTAGGGGTGGGGGTAACAGGG - Intronic
902599033 1:17528588-17528610 AATTATGGGTGGTGGACAAATGG - Intergenic
902610191 1:17592620-17592642 TGCTAGGTGTGGGGGACATAGGG + Intronic
902981797 1:20128736-20128758 AATTTGGGGTGGGGGACACATGG - Intergenic
903383405 1:22911840-22911862 AGTTAGGGGTGGCTGACACAGGG - Intronic
903395336 1:22997690-22997712 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
903439152 1:23374511-23374533 GGGGAAGGGTGGGGGACACAAGG - Intergenic
903551940 1:24163545-24163567 GATTTTGGGTGGGGGACAGAGGG - Intronic
903663795 1:24994874-24994896 GGTCAGGGGTGGGGGGCGGAGGG - Intergenic
903810916 1:26034731-26034753 GCTTGGGGATGGGGGTCAAAGGG + Intronic
904330234 1:29753907-29753929 GGTTGGGGGTTAGGGACAATAGG + Intergenic
904406882 1:30297259-30297281 GGGTTGGAGTGGGGCACAAAAGG - Intergenic
904437653 1:30508979-30509001 AGTGAGGGGTGGGGAACACAGGG + Intergenic
904531236 1:31171039-31171061 GGTTAGGGGTGGGGCAGAGTGGG + Intergenic
905149978 1:35919810-35919832 GGTGAGGGGTGGGGGACATGAGG - Exonic
905800628 1:40840026-40840048 GGTGAGGGGTAGTGGACCAATGG + Exonic
906049227 1:42856942-42856964 GGGCAGGGGTGGGGGTCACATGG - Intergenic
906077060 1:43059664-43059686 GGCTAGGGGTGGGGGGCAAGAGG - Intergenic
906105626 1:43290399-43290421 GGAGAGGGGTGTGGGACTAAGGG + Intergenic
906460914 1:46034715-46034737 TGTTGGGGGTGGGGGAGAAGGGG - Exonic
906547049 1:46627179-46627201 GGCTAGGGGTGGGGAAGAACTGG + Intergenic
907239739 1:53074805-53074827 GGTCGGGGGTGGGGGAGACACGG + Intronic
907692901 1:56688220-56688242 GGTTAGGGGTGGGGGACAAAGGG + Intronic
907999371 1:59665603-59665625 GGTTGGGGGTAGAGGGCAAATGG - Intronic
908211452 1:61904751-61904773 AGTTAGGGATGGGAGAGAAAGGG - Intronic
908573357 1:65433160-65433182 GAGTAGGGGTGGGGGGCAGAGGG - Exonic
908902186 1:68968447-68968469 TGTTGGGGGTGGGGGGCAAGGGG + Intergenic
909977980 1:82067709-82067731 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
910635109 1:89399335-89399357 TGTTAGGGGTGGGAGACTAGGGG - Intergenic
910734887 1:90442735-90442757 GGGTAGGGATGGGGGTGAAATGG + Intergenic
911578845 1:99611930-99611952 AGGGAGGGGTGGGGGATAAATGG + Intergenic
911664542 1:100538803-100538825 GGCTGGGGGAGGGGGAGAAAGGG - Intronic
911759204 1:101597403-101597425 GGACAGGGGTGGGGGTCACAAGG + Intergenic
912035167 1:105302910-105302932 GGTTAGGGGATGGGGACCCAAGG + Intergenic
912140466 1:106719620-106719642 GGGTGGGGGTGGGGTAGAAAGGG - Intergenic
912633796 1:111271802-111271824 GGGTGGGGGTGGGGGACAATGGG - Intergenic
912798096 1:112704998-112705020 TGCTGGGGGTGGGGGACACATGG - Intronic
912939460 1:114032274-114032296 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
913971343 1:143420468-143420490 GGGTAGGGCTGGGGGACCATGGG + Intergenic
914065720 1:144246081-144246103 GGGTAGGGCTGGGGGACCATGGG + Intergenic
914113431 1:144720273-144720295 GGGTAGGGCTGGGGGACCATGGG - Intergenic
915309522 1:155000275-155000297 GGTTAGGGGTTGGGGTAAGAGGG + Intergenic
915467540 1:156106242-156106264 GGTTGAGGGTGAGGGAGAAAGGG + Intronic
915497253 1:156290897-156290919 GGGTGGGGGTGGGGGAGAATAGG + Intronic
915614898 1:157029982-157030004 GGTTAGGGGAAGGGGGCAATGGG + Intronic
915941096 1:160118756-160118778 GGGTAGGGGTGGGGGATGCAAGG - Intronic
915949239 1:160176963-160176985 GGTCAGGTGTGGGAGACCAAAGG + Intronic
916705313 1:167343149-167343171 GGTCAGGGGTGGGGGTCAAGGGG + Intronic
916941494 1:169683271-169683293 GGGCAGGGGTGGGGGTCACAAGG - Intronic
916942281 1:169688516-169688538 GGGTAGGGGTGGGGGTCACAAGG - Intronic
917007593 1:170432414-170432436 GTTGGGGGGTGGGGGACAAGGGG + Intergenic
917019941 1:170575204-170575226 TGTTGGGGGTGGGGGGCAAAGGG + Intergenic
917791794 1:178503911-178503933 GCTTAGGGGCCGGGGACACATGG - Intergenic
917908286 1:179612284-179612306 GGGCAGGGGTGGGATACAAAAGG - Intronic
918054056 1:181003269-181003291 GGATAGGGATGGGGGACAGATGG - Intronic
918099392 1:181360560-181360582 GACTAGGGGTGGGGGAGAATTGG + Intergenic
918222277 1:182445652-182445674 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
918967246 1:191367260-191367282 GGGTAGAGCTGGGGAACAAATGG + Intergenic
919334589 1:196215498-196215520 GGGCAGGGGCGGGGGACACAAGG + Intergenic
919852475 1:201682316-201682338 CGGTAGGGGTGGGGGACCATGGG - Intronic
920088588 1:203435873-203435895 GGGGCGGGGTGGGGGATAAAGGG - Intergenic
920337802 1:205256959-205256981 GGGTGGGGGTGGGGGGCAAAGGG - Intronic
920375524 1:205505888-205505910 GGCTAGGGGTGGGGAAGAAGGGG - Intronic
920994059 1:210970260-210970282 TGTTGGGGGTGGGGGACAAGGGG - Intronic
921701478 1:218273405-218273427 GATTTGGGGTGGGAGAGAAATGG + Intergenic
921725919 1:218523246-218523268 GGCTAGGGGGAGGGGAGAAATGG + Intergenic
922373664 1:224939024-224939046 GGTAAGGGGAGGGGGATGAATGG + Intronic
922398860 1:225229762-225229784 TGTCAGGGGTGGGGGTCAAGGGG + Intronic
923434705 1:233956925-233956947 GGATAGGGGTAGAGGCCAAATGG + Intronic
923472327 1:234303098-234303120 TGTTGGGGGTGGGGAAGAAAGGG - Intronic
924296672 1:242593970-242593992 GATTACAGGTGGGAGACAAAGGG - Intergenic
1062931265 10:1354372-1354394 GGGCAGGGGTGGGGGTCACAAGG - Intronic
1063573332 10:7237580-7237602 GGCTAGGGGTGGGAGAGAATGGG + Intronic
1063675020 10:8133248-8133270 GGTTTGAGGTGGAGGAAAAAGGG - Intergenic
1063912101 10:10840836-10840858 GTTAGGGGGTGGGGGACAAGGGG - Intergenic
1064177711 10:13089813-13089835 GGAGGGGGGTGGGGGATAAAAGG - Intronic
1064630034 10:17300693-17300715 TTTCAGGGGTGGGGGGCAAAGGG - Intergenic
1064660715 10:17605078-17605100 GGCTAGGGGCTGGGGACAGATGG + Intronic
1064957989 10:20932418-20932440 GCTGGGGGGTGGGGGAGAAAGGG + Intronic
1065442690 10:25769143-25769165 GGGTAGGAGTGGGGGTCACAAGG + Intergenic
1066099030 10:32100738-32100760 GTTGGGGGGTGGGGGACAAGGGG - Intergenic
1066163804 10:32763813-32763835 GCTGAGGGAAGGGGGACAAATGG + Intronic
1066436454 10:35400336-35400358 GGTGAGGGGAGGGGGAAAACAGG - Intronic
1067154079 10:43760410-43760432 GGTTGTGGGTGGGGGACAAAGGG + Intergenic
1067293114 10:44958934-44958956 TGTTAGGGGTGGGAGAGAACAGG + Intergenic
1067361873 10:45589559-45589581 GGGTAGGGGGTGGGGAAAAATGG - Intronic
1067684122 10:48457025-48457047 GGGCAGGGGTGGGGCAGAAAGGG + Intronic
1067712732 10:48662866-48662888 GGCCAGGGGTTAGGGACAAATGG + Intergenic
1069308368 10:67001442-67001464 AGACAGGGGTGGGGGACAGAAGG + Intronic
1069463856 10:68620565-68620587 GGGTGGGGGTGGTGTACAAATGG - Intronic
1069568467 10:69479516-69479538 GGCTGGGGGTGGGGGGCACACGG - Intronic
1069789942 10:71013118-71013140 GGGTGGGGGTGGGGGAGGAAGGG - Intergenic
1069909622 10:71751392-71751414 GGTTGAGGGTGAGGGACAGAGGG - Intronic
1069909645 10:71751460-71751482 GGTTGAGGGTGAGGGACAGAGGG - Intronic
1069909668 10:71751528-71751550 GGTTGAGGGTGAGGGACAGAGGG - Intronic
1070286499 10:75087492-75087514 GGGTGGGGGTGGGGGAAGAATGG + Intergenic
1070322109 10:75362251-75362273 GGTTAGGGGTGGGGGATCCTGGG + Intergenic
1070702909 10:78616370-78616392 GGTTGGGGGTGGGGTGGAAATGG + Intergenic
1070998952 10:80812691-80812713 TGTCAGGGGTAGGGGAAAAAGGG - Intergenic
1071178964 10:82960797-82960819 GGGCAGGGGTGGGGGTCACAAGG - Intronic
1071187777 10:83063156-83063178 GGACAGGGGTGGGGGTCACAAGG - Intergenic
1071535011 10:86421256-86421278 GGTTTGGTGTCAGGGACAAATGG + Intergenic
1072082436 10:92045538-92045560 GGCCAGGGGAGGGGGACCAAAGG + Intergenic
1072194992 10:93109891-93109913 GGTTATGGGAGGGGGAGAAGGGG + Intergenic
1072371448 10:94769512-94769534 GTTTAGGGGTTGGGTACAACTGG + Intronic
1072952901 10:99863618-99863640 GTTGGGGGGTGAGGGACAAAGGG - Intergenic
1073105399 10:101029934-101029956 GGGTGGGGGTAGGGGACAATGGG - Intronic
1073289444 10:102406129-102406151 AGTATGGGGTGGGGGACCAAGGG - Intronic
1073715579 10:106102961-106102983 GTTGGGGGGTGGGGGGCAAAAGG - Intergenic
1074032662 10:109704164-109704186 GTTGAGGGGTGGGGGACAAGGGG + Intergenic
1074083328 10:110185589-110185611 TGTCAGGGGTGGGGGGCAAGGGG - Intergenic
1074132167 10:110589501-110589523 GGATGGGGGAGGCGGACAAAAGG - Intronic
1074147251 10:110727796-110727818 GTTGAGGGATGGGGGACAAGGGG - Intronic
1074165917 10:110872975-110872997 GATTAGGTGTCGGGGAAAAAAGG + Intronic
1074737808 10:116453931-116453953 TGTTGGGGGTGGGGGACAAGGGG - Intronic
1074877564 10:117626045-117626067 GGGTAGGGTTGAGGCACAAATGG + Intergenic
1075030861 10:119023816-119023838 GGTTGGGGGTGGGGGGCACATGG + Intergenic
1075061009 10:119256619-119256641 GGTGAGGGGTGGGGTGCAATAGG - Intronic
1075885199 10:125894213-125894235 AGATAGGGGTGGGGGATGAATGG - Intronic
1076352473 10:129826552-129826574 GCTTAGGGCTGGGGGACATGGGG - Intergenic
1076435146 10:130435640-130435662 GTTTAGGGGTAGGGGGCATACGG - Intergenic
1076588743 10:131569108-131569130 GCTGAGGGGTGGTGGAGAAAGGG + Intergenic
1076824855 10:132961724-132961746 GGTGAGGGGTGGGGGATCAGGGG - Intergenic
1077002944 11:333952-333974 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1077310409 11:1886449-1886471 GGGTAGGGCTGGGGGACCATGGG - Intronic
1077311562 11:1891095-1891117 GGTGAGGGGTGGCGGCCAAGAGG + Intronic
1077817025 11:5695842-5695864 GTTTTGGGTTGGGGAACAAAAGG + Intronic
1077883047 11:6366230-6366252 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1077883853 11:6371452-6371474 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1077898670 11:6473377-6473399 GGGTGGGGGTGGGGGAGCAAGGG + Intronic
1079909880 11:26296577-26296599 GGTTAGGGGTTAGGAAAAAAGGG + Intergenic
1080834558 11:35928280-35928302 GGTTAGGGCTGAGAGAAAAAAGG - Intergenic
1080848343 11:36045959-36045981 TGTTGGGGGTGGGGGACGAAGGG - Intronic
1080996264 11:37606088-37606110 GTTCAGGGGTGGGGGGCAAGGGG - Intergenic
1081637728 11:44731880-44731902 GGTGAAGGGTGGGAAACAAAGGG - Intronic
1081992054 11:47343219-47343241 GGCTTGGGGTGGGGGGCACAGGG - Intronic
1082197183 11:49320770-49320792 GGACAGGGGTGGGGGTCACAAGG + Intergenic
1082692497 11:56323628-56323650 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1083244012 11:61411694-61411716 GGATAGGGAGTGGGGACAAATGG - Intronic
1083339347 11:61948878-61948900 GTGTGGGGGTGGGGGACAAGGGG + Intergenic
1083507563 11:63173213-63173235 TGTTGGGGGTGGGGGGCAAGGGG + Intronic
1083534989 11:63459304-63459326 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1084165147 11:67372191-67372213 GGCTAGGGGTGGGGGGCACTGGG - Intronic
1084512523 11:69615233-69615255 GGTTATGGGTAGGGGAGAACTGG - Intergenic
1084648293 11:70473595-70473617 GGGTGGGGGAGGGGGAGAAAGGG + Intronic
1084764950 11:71302122-71302144 TCTTGGGGGTGGGGGACACAGGG + Intergenic
1084870816 11:72097592-72097614 GGGATGGGGTGGGGGCCAAAAGG - Exonic
1085281134 11:75331584-75331606 GGGCAGGGGTGGGGGTCACAAGG - Intronic
1085281205 11:75332033-75332055 GGGTAGGGGCGGGGGTCAAAAGG - Intronic
1085398990 11:76224358-76224380 GGTTGGGGGTGGGGGACAGCGGG + Intergenic
1085505603 11:77056895-77056917 GGGTGGGGGTGGGGGGCATATGG - Intergenic
1085671229 11:78466255-78466277 GGGTGGGGGTGGGGGAGCAATGG - Intronic
1085707635 11:78800861-78800883 GGTGAGGGTTGGGGGAGAAAAGG + Intronic
1086005506 11:82030801-82030823 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1086234856 11:84617129-84617151 GTTGAGGGGTGGGGGGCTAAGGG - Intronic
1086256545 11:84883305-84883327 GTTAGGGGGTGGGGGACAAGGGG + Intronic
1086972853 11:93102305-93102327 TTTTAGGGGTGGGGGGCAAGGGG - Intergenic
1087007366 11:93483118-93483140 TGTGAGGGTTGGGGGACTAAAGG + Intronic
1087278157 11:96180925-96180947 GGGTAGGAGTGGGGGTCACAAGG + Intronic
1087284551 11:96250996-96251018 GGTAAGGGGTGAGGGAGAAGAGG + Intronic
1087384045 11:97447015-97447037 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1087839890 11:102909684-102909706 GGGTAGGAGTGGGGGTCACAAGG + Intergenic
1087846627 11:102980818-102980840 GGTTGGGGATGGGGGGCAAGGGG + Intergenic
1088061389 11:105655483-105655505 GTTGAGGGGTGGGGGACTAGGGG - Intronic
1088171274 11:106999941-106999963 GGTTGCGGGTGAGGGAAAAATGG - Intronic
1088391742 11:109321841-109321863 GGTGGGGGGTTGGGTACAAATGG + Intergenic
1088405449 11:109470974-109470996 GTTGAGGGGTGGGGGGCAAGGGG + Intergenic
1088645372 11:111912942-111912964 GGGTGGGGGTGGGGGGCAAGGGG - Intronic
1088850815 11:113701948-113701970 GACTGGGGGTGGGGGACAAGGGG - Intronic
1088939213 11:114436662-114436684 GGATGGGGGTGGGGGAGTAATGG + Intronic
1089173337 11:116531322-116531344 AGTTAGGGGTGGGAGTGAAATGG + Intergenic
1089753778 11:120670850-120670872 GTCGAGGGGTGGGGGACAAGGGG - Intronic
1089762479 11:120738530-120738552 GGTAGGGGGTGGGGGATGAACGG - Intronic
1090082411 11:123622866-123622888 GGGAAGGGGTGGGGAACAGAGGG - Intronic
1090146080 11:124324554-124324576 TCTCAGGGGTGGGGGACAAGAGG - Intergenic
1090451057 11:126806828-126806850 TGTTGGGGGTGGGGGGCAAGGGG - Intronic
1090662993 11:128895088-128895110 GGGTGAGGGTGGGGGAGAAATGG + Intronic
1091215324 11:133897962-133897984 GGTTTGGGGTGGGTGACTTAGGG - Intergenic
1091224270 11:133948403-133948425 GGTTGGGGGTGGGGGAAATTGGG - Intronic
1092426563 12:8380138-8380160 CGTCGGGGGTGGGGGACAAGGGG + Intergenic
1093071498 12:14710346-14710368 GGGTAGGAGTGGGGGTCACAAGG + Intergenic
1093072933 12:14725076-14725098 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1093300099 12:17443073-17443095 GGGGTGGGGTGGGGGACATAGGG + Intergenic
1094401246 12:30062309-30062331 GGGAAGGAGTGGGGGACACAAGG - Intergenic
1094739111 12:33268423-33268445 GGTTAGGAGGGAGGGAAAAAGGG + Intergenic
1095349076 12:41188434-41188456 TGTTAGGGATGGGGAAGAAAGGG - Exonic
1095684700 12:45020199-45020221 GCTTAGGGCTGGGGGAAACAGGG - Intronic
1095805947 12:46321486-46321508 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1096146486 12:49282464-49282486 GGTGAGGGGTGGTGGAAAGAGGG - Intergenic
1096232761 12:49905578-49905600 GTTATGGAGTGGGGGACAAAGGG - Intergenic
1096557712 12:52413745-52413767 GGGCAGGGGTGAGGGTCAAAGGG - Intergenic
1096887956 12:54736434-54736456 GGGTAGGGGTGGGGGTCACAAGG - Intergenic
1097768986 12:63558434-63558456 GGGTGGGGGTGGGGGGCAAGGGG - Intergenic
1097882105 12:64695538-64695560 AGTTAGGGGTAGTGGAGAAAGGG + Exonic
1098639989 12:72826549-72826571 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1099104275 12:78480271-78480293 GTGTAGGGGTTGGGGACAATGGG - Intergenic
1099835620 12:87907473-87907495 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1099836400 12:87912676-87912698 GGGCAGGGGTGGGGGTCACAGGG + Intergenic
1100250753 12:92820855-92820877 GGTGAGGGGTGAGGGAGAATTGG - Intronic
1100562900 12:95767150-95767172 GGTGAGGGGTGGGGAAGAAAGGG - Intronic
1100723528 12:97384727-97384749 GGTTAAGGGGGTGGGAGAAAAGG + Intergenic
1101706612 12:107226376-107226398 TGGTGGGGGTGGGGGGCAAAGGG - Intergenic
1101848722 12:108385335-108385357 GGTCAGGGGTGGGGGACATATGG + Intergenic
1101922974 12:108947842-108947864 GGTGGGGGTTGGGGGATAAAGGG + Intronic
1102656479 12:114486192-114486214 GCTTGGTGGTGGGGGGCAAATGG - Intergenic
1103053474 12:117800745-117800767 GTTGAGGGGTGGGGGAAAAGGGG - Intronic
1103936648 12:124480837-124480859 GGTAGGGGGTGGGGGAGCAAGGG + Intronic
1103950109 12:124545797-124545819 GGGTGGGGGTGGGGGACGAGTGG + Intronic
1104258295 12:127159583-127159605 GATCATGGGTGGGAGACAAATGG + Intergenic
1104488579 12:129174223-129174245 GTTGAGGGGTGGGGGGCAAGGGG - Intronic
1105031873 12:132889757-132889779 GGGCAGGGGTGGGGGTCACAAGG - Intronic
1105261882 13:18785667-18785689 GGGTAGGGGTGGAAGAAAAAAGG - Intergenic
1105626506 13:22118019-22118041 GGGTAGGGCTGGGGGAGGAAGGG - Intergenic
1106178098 13:27348324-27348346 GGTTTGGGGTGGGGGTCAATGGG + Intergenic
1106227986 13:27799420-27799442 ATTTAGGGGTGGGGAACCAATGG - Intergenic
1106575226 13:30968245-30968267 GGTTATGGGAGGGGGAGAAGAGG + Intronic
1106783831 13:33087453-33087475 GGGTAGGGGTGGGGGACACTAGG - Intergenic
1106823481 13:33492045-33492067 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1107269064 13:38593232-38593254 GTTGGGGGGTGGGGGACAAGGGG - Intergenic
1107786815 13:43965727-43965749 GGTCTGGGCTGGGGCACAAATGG + Intergenic
1107797369 13:44066356-44066378 TGCCAGGGGTGGGGGACGAAGGG + Intergenic
1108391257 13:49950032-49950054 GGAGAGGGGTGAGGGATAAAAGG + Intergenic
1109004721 13:56857476-56857498 TGTGGGGGGTGGGGGACAAGGGG + Intergenic
1109709203 13:66141518-66141540 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1109904873 13:68827585-68827607 GTTGAGGGGTAGGGGACAAGGGG - Intergenic
1110328360 13:74243101-74243123 TGTCAGGGGTGGGGGACAAGGGG - Intergenic
1110337835 13:74352552-74352574 GTCAAGGGGTGGGGGAAAAAGGG + Intergenic
1110800173 13:79684974-79684996 GGAAAGGGGTGGGAGACCAAGGG - Intergenic
1110979000 13:81872224-81872246 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1111861853 13:93717756-93717778 TGTCAGGGGTGGGGGGCAAGGGG - Intronic
1112395043 13:99021808-99021830 GTCAAGGGGTGGGGGACAAGGGG + Intronic
1112587124 13:100728541-100728563 GGTGAGAGGTGGGGGAGAACTGG + Intergenic
1112781653 13:102907137-102907159 GGATAGGGATTGGGGAGAAATGG + Intergenic
1114197871 14:20494957-20494979 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1114267468 14:21081471-21081493 GGTTGGGGATGGGAGAGAAAGGG - Intronic
1114487360 14:23070828-23070850 GGTTAGGGGGAGGGGAAAATCGG + Intronic
1114598094 14:23931383-23931405 GGTGAGTGGTGGGCGACCAAGGG + Intergenic
1114648792 14:24270253-24270275 GTCTAGGGGTGGAGGAGAAATGG - Intronic
1115357732 14:32466571-32466593 GTTGGGGGGTGGGGGACAAAGGG + Intronic
1116952558 14:50893402-50893424 GGGCAGGGGTGGGGGTCACAAGG - Intronic
1117441975 14:55768491-55768513 ACTTAGGGGTGGGGGAAATAGGG + Intergenic
1118210868 14:63764727-63764749 GTTGTGGGGTGGGGCACAAAGGG - Intergenic
1118335246 14:64847838-64847860 GGTTTGCGGTGGGGGGCACATGG - Intronic
1118775510 14:68971700-68971722 GGTCAGGGCTGGGGGACCTAGGG - Intronic
1119034179 14:71215802-71215824 GGTTAGGGGTGGGGAAGTGAAGG + Intergenic
1119525727 14:75320876-75320898 GGTGGGGAGTGGGGGACAGACGG - Intergenic
1120001077 14:79303629-79303651 TGTTGGGGGTGGGGGGCTAAAGG + Intronic
1120115279 14:80609459-80609481 GGATGGGGGTGGGGGCCAGAGGG - Intronic
1120303265 14:82735264-82735286 GGTTCAAGGTGGGGGAGAAATGG + Intergenic
1120542357 14:85765916-85765938 GGGGAGGGATGGGGGATAAAGGG + Intergenic
1120987142 14:90344075-90344097 GGTTTGGGGAGGGGTACAAAGGG - Intergenic
1121157464 14:91700078-91700100 GTCGAGGGGTGGGGGACAAAAGG - Intronic
1121488861 14:94343594-94343616 GGTTAGGGGTGGGGGCAAGGAGG + Intergenic
1121605243 14:95235808-95235830 GGAGAGGGGAGGGAGACAAAGGG + Intronic
1122574556 14:102733423-102733445 GGTGGGGGGTGGGAGAGAAAAGG - Intergenic
1202899939 14_GL000194v1_random:29228-29250 GGTTAGGGGTTAGGGATAAGGGG + Intergenic
1202872850 14_GL000225v1_random:179717-179739 AGATAGGGGTGGGGGATGAATGG + Intergenic
1123400993 15:19986235-19986257 TGTTGGGGGTGGGGGGCAAGAGG + Intergenic
1124448245 15:29759619-29759641 GGTTAGGGGTGGGGAGGAATGGG - Intronic
1124667295 15:31604440-31604462 GTTGAGGGGTGGGGGGCCAAGGG + Intronic
1125647635 15:41285507-41285529 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1126104554 15:45139036-45139058 GGTTGGGGGTGGGGAGGAAAGGG - Intronic
1126629121 15:50715602-50715624 GGGTGGGGGTGGGGGAAGAATGG + Intronic
1126838151 15:52688559-52688581 GGATGGGGGTTGGGGAGAAAAGG + Intronic
1126995252 15:54435579-54435601 GGGTGGGGGTGGGGGACTAGGGG + Intronic
1127876642 15:63117298-63117320 TGTTAGGGGAGGGGGAAAACGGG - Intergenic
1127991553 15:64122574-64122596 GGTGAGGGGTGAGGGGCCAAGGG - Intronic
1129589809 15:76905165-76905187 GGTGAGGGGAGGGGGTGAAAGGG + Intronic
1130304243 15:82702567-82702589 GGGCAGGGGCGGGGGACACAAGG - Intronic
1130508788 15:84571030-84571052 GGTGAGGGGTGAGGGACGAGAGG - Intergenic
1130678991 15:85980037-85980059 GCTGAGAGGTGGAGGACAAATGG + Intergenic
1131177802 15:90220857-90220879 GGTGAGGTGTGTGGGACAGAAGG - Intronic
1132216471 15:100065866-100065888 GTTGAGGGGTGGGGGAAAAGGGG - Intronic
1132411712 15:101583861-101583883 CGTTGGGGGTCGGGGACAAGGGG - Intergenic
1133389801 16:5400775-5400797 TGTTGGGGGTGGGGAAGAAAAGG - Intergenic
1133707908 16:8372808-8372830 CGTTGGGGGTGGGGAACAAGGGG + Intergenic
1133845472 16:9449306-9449328 GGTTGGGGGTGGAGGAAAGATGG + Intergenic
1133899820 16:9963427-9963449 TGTCAGGGGTGGGGGGCAAGAGG - Intronic
1134240762 16:12504400-12504422 GGCTGGGGGTTGGGGAGAAATGG - Intronic
1134342544 16:13358377-13358399 GTTGGGGGGTGGGGGACAAAGGG - Intergenic
1134798392 16:17062277-17062299 GGTAAGGGGTGGGAGTCCAAAGG - Intergenic
1135759889 16:25128902-25128924 TGTCAGGGGTGGGGGGCAAGGGG + Intronic
1135862674 16:26071252-26071274 GGTGAGGGGTGAGGGAGAAAGGG + Intronic
1135948070 16:26882962-26882984 TGTTGGGGGTGGGGGACAAAAGG + Intergenic
1135970186 16:27066767-27066789 GGGTAGGAGTGGGGCAGAAAGGG - Intergenic
1136649704 16:31658347-31658369 GTTGGGGGGTGGGGGGCAAAGGG + Intergenic
1138200618 16:55085524-55085546 GTTGGGGGGTGGGGGGCAAAGGG + Intergenic
1138249040 16:55488522-55488544 GGCTAAGGGTGGGGGAGAGAGGG - Exonic
1138440832 16:57034142-57034164 GGGTAGGAGTGGGGGACAGAAGG - Intronic
1138506088 16:57479025-57479047 GGCCGGGGGTGGGGGGCAAACGG + Intronic
1138916894 16:61475292-61475314 GCTTAGGGGTGGGGGACTAGGGG + Intergenic
1138929614 16:61636541-61636563 TTTTGGGGGTGGGGGACTAAGGG + Intergenic
1139333250 16:66210657-66210679 GTTGGGGGGTGGGGGACAAAGGG - Intergenic
1139752474 16:69118114-69118136 GGGTGGGGGTGGGGGATGAAGGG - Exonic
1141036707 16:80632997-80633019 GGTAAGGGGTGGCGGCCAGAGGG - Exonic
1141119918 16:81345591-81345613 TGTTAGGGGTGGGGGCCTAGGGG + Intronic
1141334446 16:83141663-83141685 TGTTGGGGGTTGGGGACAAAAGG - Intronic
1142156972 16:88537096-88537118 GGTTTGGGGTGGGGCTCAAAGGG - Intergenic
1142875929 17:2852340-2852362 GGGTGGGGGTGGGGGGCACAAGG + Intronic
1143056189 17:4163564-4163586 GGGTTGGGGTGAGGGATAAAAGG + Intronic
1143164300 17:4890188-4890210 GGTGTGGGGTGGGGGGCAGAGGG - Intronic
1143431641 17:6892256-6892278 TGTGAGGGGTGGGGGTCAATGGG + Intronic
1144007144 17:11111009-11111031 TTTGAGGGGTGGGGGACAAGGGG + Intergenic
1144187759 17:12812097-12812119 GGTCAGGGGTGGGGAACATGAGG + Intronic
1144493191 17:15731876-15731898 GGTTGAGGGTTGGGGGCAAAAGG - Intergenic
1144728095 17:17511782-17511804 GGGCAGGGGTGGGGGACAAGAGG - Intronic
1144907065 17:18644776-18644798 GGTTGAGGGTTGGGGGCAAAAGG + Intronic
1146147818 17:30437128-30437150 GAGTAGGGGTTGGGGAAAAATGG + Intronic
1146281644 17:31549142-31549164 GACTGGGGATGGGGGACAAAGGG - Intergenic
1146613781 17:34334568-34334590 TATCAGGGGTGGGGGACAAGGGG - Intergenic
1146795600 17:35778290-35778312 GGCTAGGGGAGGGGGAGAAGGGG + Intronic
1146834492 17:36099255-36099277 GGTTGAGGGTGGGGGAGAAGGGG + Intergenic
1146849103 17:36206441-36206463 GGTTGAGGGTGGGGGAGAAGGGG + Intronic
1147416802 17:40297473-40297495 TGTTGGGGGTGGAGGCCAAAGGG + Intronic
1147811570 17:43173822-43173844 GGGTGGGGGTGGGGGGCAGAGGG - Intronic
1148381965 17:47206324-47206346 GGAGTGGGGTGGGGGAAAAAAGG + Intronic
1148453774 17:47799330-47799352 GGTTTGGGGTGAATGACAAAGGG + Intergenic
1148597494 17:48868393-48868415 GGCTAGGGGTTGGGGGGAAATGG + Intergenic
1149406838 17:56360985-56361007 GGCTAGGGGTGGGGAAAATAGGG - Intronic
1149511858 17:57248741-57248763 GGTTGAGGGTGGGGAATAAAGGG + Intergenic
1149547501 17:57514901-57514923 GGTTTGGGGTGGGGTACCCATGG - Intronic
1150115025 17:62539985-62540007 GGTTTCGGGTGGGGAACAGAAGG - Intronic
1150610243 17:66727741-66727763 GGCTAGGGATGGGGGAGAAACGG + Intronic
1151011024 17:70496043-70496065 GCTGAGGGGTGGGGGAAAAGGGG + Intergenic
1151150003 17:72076883-72076905 GGCAAGGGTCGGGGGACAAAGGG - Intergenic
1151316136 17:73323917-73323939 GCCTGGGGGTGGGGGACAAGGGG - Intergenic
1151376313 17:73691318-73691340 GGTCAGGGTTGGGTCACAAATGG - Intergenic
1151762320 17:76112283-76112305 GGTTGGGGGAGGGAGACAGAGGG + Intronic
1152324609 17:79628238-79628260 TGTTTGGGGTGGGGAACAGAAGG - Intergenic
1152784567 17:82241120-82241142 GGGTGGGGGTGGGGGGCAGAGGG + Intronic
1153463366 18:5362060-5362082 TGTTGGGGGTGGGGAGCAAAGGG + Intergenic
1154424160 18:14259305-14259327 GGTTAGCGGTGGAAGAAAAAAGG + Intergenic
1154429561 18:14298041-14298063 GGTTAGGGGTGGAAGAAAAAAGG + Intergenic
1154431829 18:14314387-14314409 GGTTAGGGGTGGAAGAAAAAAGG + Intergenic
1156179204 18:34583323-34583345 GTTTGGGGGTGGGGGCCAACGGG - Intronic
1156237069 18:35216210-35216232 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1156937043 18:42722164-42722186 GGTTAGGGGTTGGGGATTCAAGG + Intergenic
1157574464 18:48734213-48734235 TGCTGGGGGTGGGGGACAGAAGG - Intronic
1157834029 18:50882574-50882596 TGTTATGTGTGGGGGACAATTGG + Intronic
1157982770 18:52400939-52400961 GTTGAGGGGTGGGGGACTAGGGG + Intronic
1158023830 18:52872229-52872251 GGTTATGGGAGGGGAAGAAAAGG + Intronic
1158406776 18:57166626-57166648 GGTTAGGGGTGGGGGGTGGAGGG + Intergenic
1158419864 18:57283646-57283668 GTTGGGGGGTGGGGGACAAGGGG - Intergenic
1158484882 18:57857574-57857596 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1158759761 18:60370654-60370676 GGTTTGGGGTGGGTGGGAAAAGG - Intergenic
1158767653 18:60474242-60474264 TGTTGGGTGTGGGGGACAAGGGG + Intergenic
1159834686 18:73324838-73324860 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1160744285 19:703583-703605 GGGTTGGGGTGGGGGCCATAAGG + Intergenic
1160791977 19:927286-927308 GGGTGGGGGTCGAGGACAAAGGG + Intronic
1160926500 19:1549267-1549289 GGTTGGATGTGGGGGTCAAAGGG - Intergenic
1161015082 19:1979426-1979448 GGTGGGGGGTGGGGGGCACAGGG - Intronic
1161420775 19:4174965-4174987 GGTCAGGCGTGGGGGACAGAGGG + Intronic
1162363186 19:10231481-10231503 GGGTGGGGGGGGCGGACAAAGGG - Intergenic
1162566118 19:11446592-11446614 GGACAGGGGTGGGGGAGGAAGGG - Intronic
1162789176 19:13054206-13054228 GGTGGGGGTTGGGGGACAAGTGG + Intronic
1163034341 19:14562661-14562683 GGCAGGGGGTGGGGCACAAAGGG - Intronic
1163943959 19:20519018-20519040 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1164202777 19:23032029-23032051 GGTCAGGGGTGGGGGTCACAAGG + Intergenic
1164314954 19:24079352-24079374 GGGTAGGGAGGAGGGACAAATGG - Intronic
1164460024 19:28438822-28438844 TGTTGGGGGTGGGGGGCAAGGGG + Intergenic
1164792240 19:30997076-30997098 GGTGAGGAGAGGGGGACAATTGG + Intergenic
1165080350 19:33302894-33302916 GGGTAGGGGTGGGGGGCGGAGGG + Intergenic
1165129636 19:33623488-33623510 GGAGAGGGGCGGGGGACAGAGGG + Intronic
1165149083 19:33750503-33750525 GCTTAGGGGTGGGGGATACAGGG - Intronic
1165317941 19:35067940-35067962 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1165423864 19:35735110-35735132 AGTGAGGGTTGGGGGACACAGGG + Intronic
1166120686 19:40684581-40684603 GGTCAAGGGTGGGGGTCAGAAGG + Intronic
1166352091 19:42204077-42204099 AGGTGGGGGTGGGGGACAAGAGG - Intronic
1166429038 19:42708023-42708045 GTTGAGGGGTGGGGGACTAGGGG - Intronic
1166442688 19:42829389-42829411 GTTGAGGGGTGGGGGACTAGGGG - Intronic
1166450484 19:42895832-42895854 GTTGAGGGGTGGGGGACTAGGGG - Intronic
1166468519 19:43056628-43056650 GTTGAGGGGTGGGGGACTAGGGG - Intronic
1166479655 19:43160105-43160127 GTTGAGGGGTGGGGGACCAGGGG - Intronic
1166650028 19:44566152-44566174 GGTTAGGGATGGGGGAAAAGAGG + Intergenic
1166653305 19:44591681-44591703 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1166656544 19:44616128-44616150 GCGTAGGGGTGGAGGTCAAAGGG + Intronic
1167275724 19:48538058-48538080 GGTGGGGGGTGGGGGGCAAGGGG - Intergenic
1167582644 19:50355366-50355388 GTTGAGGGCTGGGGGACAAAGGG - Intronic
1167694849 19:51009343-51009365 GGGTGGGGATGAGGGACAAAGGG + Intronic
1167902595 19:52633197-52633219 GGGCAGGGGTGGGGGCCACAAGG - Intronic
1167922048 19:52789959-52789981 GGGTAGGAGTGGGGGTCACAAGG + Intronic
1168151296 19:54450199-54450221 GGGTAGGGCTGGGAGAGAAAAGG - Intronic
1168461514 19:56562941-56562963 GGTTAGGGGTGGTGGAGGAGGGG - Intergenic
1168558321 19:57362274-57362296 GGTCAGGGGTGGGGGGCAGGGGG - Intergenic
1202647550 1_KI270706v1_random:156447-156469 GGTTAGGGGTTAGGGATAAGGGG - Intergenic
925511977 2:4638056-4638078 GTTGGGGGGTGGGGGACAAGGGG + Intergenic
925607558 2:5673800-5673822 GGCCGGGGGTGGGGGACAGAGGG + Intergenic
926279429 2:11433310-11433332 GTCAAGGGGTGGGGGACAAGGGG - Intergenic
927043592 2:19254676-19254698 GTTTAGGGGTGGGGGGCTAGGGG + Intergenic
927133885 2:20082786-20082808 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
927484384 2:23478780-23478802 GCTGAGGGCAGGGGGACAAACGG - Intronic
927523146 2:23713567-23713589 GGTTAGGGGTTGGGGAGAATGGG - Intergenic
927860386 2:26556998-26557020 GGGTTGGGGTGGGAGGCAAAAGG + Intronic
927913135 2:26915509-26915531 GGTCAGGGATGGCCGACAAAGGG - Intronic
928233023 2:29516271-29516293 GGACAGGTGTGGGGGACTAAAGG - Intronic
929257181 2:39825133-39825155 TGTTGGGGGTGGGGGGCTAAGGG - Intergenic
929775707 2:44929465-44929487 GGTTTGGGGTGGGGGCCGCAGGG + Intergenic
929996983 2:46834137-46834159 GGCCTGGGGTGGGGTACAAATGG - Intronic
930040408 2:47118147-47118169 GGTGAGGGGTGGGCGAGCAAGGG + Intronic
931551806 2:63454349-63454371 GTTTGGGGGTGGGGGACTGAGGG + Intronic
931571649 2:63675063-63675085 AGTTTGGGGTGGGGTTCAAAAGG - Intronic
932159801 2:69449129-69449151 TGGCAGGGGTGGGGGACACAAGG + Intergenic
932528234 2:72496610-72496632 GGGTAGGGGAGGGGAACAGAGGG + Intronic
932584794 2:73020916-73020938 GGTTAGAGGTTGGGGACAGGAGG - Intronic
932689099 2:73897262-73897284 AGTTTGGGGAGGGAGACAAAAGG + Exonic
932838220 2:75057276-75057298 GGGCAGGGGCGGGGGACACAAGG - Intronic
933149270 2:78894389-78894411 GGTTAGGGGAGAGGGAGAAATGG + Intergenic
933280023 2:80322908-80322930 GGCAAGGGGTGGGCTACAAAGGG - Intronic
933449999 2:82436848-82436870 GGTCTTGGATGGGGGACAAAAGG - Intergenic
934036438 2:88092294-88092316 ATTTGGGGGTGGGGTACAAATGG + Intronic
934176038 2:89581401-89581423 GGGTAGGGCTGGGGGACCATGGG + Intergenic
934286348 2:91655763-91655785 GGGTAGGGCTGGGGGACCATGGG + Intergenic
934772335 2:96914975-96914997 GGGCAGGGGTGGGGGGCAATGGG + Intronic
934797678 2:97114289-97114311 GGTGAGGGGTGGGGGTGAATGGG + Intronic
935710554 2:105894561-105894583 AGTTAGTCGTGGGGGACACATGG - Intergenic
936162823 2:110097689-110097711 GGTTTGGGGTGGGGCAGACAAGG + Intronic
936387097 2:112040467-112040489 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
936793786 2:116183940-116183962 GGGCAGGGGTGGGGGTCATAAGG + Intergenic
936794566 2:116189487-116189509 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
936883791 2:117284300-117284322 GGGTAGGAGTGGGGGTCACAAGG - Intergenic
937249390 2:120514043-120514065 GGTTAGGGGTGGGGGTACAGGGG - Intergenic
937341549 2:121094449-121094471 GGGTTGGGGTGGGGGGCACAAGG + Intergenic
937377535 2:121347933-121347955 GGTGGGGGGTGGGGGAGAGAGGG - Intronic
937827480 2:126382375-126382397 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
938172534 2:129092204-129092226 GGTGGGGAGTGGGGGACTAAAGG + Intergenic
938791356 2:134679152-134679174 GATCTGGGGTGGGGGACACAAGG + Intronic
938976676 2:136485207-136485229 GTTGAGGGGTGGGGGGCAAAGGG + Intergenic
939548845 2:143588480-143588502 TGTTAGGGGTGGGGAGCAAGGGG - Intronic
939991047 2:148876605-148876627 GGGAGGGGGTGGGGGAGAAAAGG - Intronic
940123231 2:150292316-150292338 GAGTAGGGGTGGGGGCAAAAAGG - Intergenic
940432691 2:153611851-153611873 GTTGGGGGGTGGGGGACAAGGGG - Intergenic
940855916 2:158728626-158728648 GGAGAGGGGTGGGGGCCACAGGG + Intergenic
940950467 2:159666924-159666946 TGTTGGGGGTGGGGGGCAAGGGG + Intergenic
941148679 2:161886936-161886958 GTTGAGGGGTGGGGGACTAGGGG - Intronic
941262741 2:163317940-163317962 GATTAGGGGTAGGGGACAGAGGG - Intergenic
941702849 2:168623246-168623268 GGATAGGAGTGGGGGAAAGAGGG + Intronic
941938738 2:171010220-171010242 TGTGAGGGGAGGGGAACAAAGGG + Intronic
942315589 2:174693799-174693821 GGTAAGGAGTGGTGGGCAAATGG + Intergenic
942363752 2:175199842-175199864 GGGCAGCGGTGGGGGACACAAGG + Intergenic
943208279 2:184928467-184928489 GGTTAGGGGAGGGGGAGGAGTGG + Intronic
943450646 2:188038931-188038953 GGTCAGGGGTGGGGGTCACAAGG - Intergenic
944264599 2:197709506-197709528 GGGCAGGGGTGGGGGTCACAAGG + Intronic
944680546 2:202073125-202073147 GGATGGGGGTGGGGGTCAAATGG - Intergenic
944923760 2:204441794-204441816 GCTTTGGTTTGGGGGACAAAAGG + Intergenic
944992775 2:205256534-205256556 GATTATGGTTGGGGGTCAAAGGG + Intronic
945760996 2:213915274-213915296 GCTGAGGGGTGGGGGACTAGGGG - Intronic
945948728 2:216018862-216018884 GGTTAGGGGTGAGGGATGGAAGG - Intronic
946328356 2:218996482-218996504 GGTTAGGGGAGGAGGAAAAGCGG + Intergenic
946655212 2:221939056-221939078 GGTGAGGGTTGGGGGTCAGAAGG - Intergenic
947911202 2:233802142-233802164 GGGTAGGGGTGGGAGAGAAAGGG - Intronic
948034532 2:234847378-234847400 GGCAAGGGGTGGGGGACAGGTGG + Intergenic
948137349 2:235646619-235646641 AGTTAGGGGCGGGGGCCCAAGGG - Intronic
948309684 2:236975740-236975762 GGTTAGGTGGGGTGGACAGAAGG - Intergenic
948779884 2:240312585-240312607 GGAGAGGGGTGAGGGATAAAAGG - Intergenic
948918344 2:241049796-241049818 GGCTGGGGGCGGGGGACAGAGGG - Exonic
949049060 2:241887516-241887538 GGGTGGGGGTGAGGGGCAAATGG - Intergenic
1168820030 20:766585-766607 GGGCAGGGGTGGGGGTCACAAGG - Intronic
1168881596 20:1210949-1210971 AGTCAGGGGTGGGGGGCAAGGGG - Intergenic
1168943605 20:1733325-1733347 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1169228029 20:3868215-3868237 GTTTAGGGTAGGGGGACAGAGGG - Exonic
1169498806 20:6139647-6139669 GCTGGGGGCTGGGGGACAAAGGG - Intergenic
1169594129 20:7178615-7178637 GGTTGTGGGTGGGGGCCAAGAGG - Intergenic
1170193096 20:13663147-13663169 GGTGGGGGGTAGGGGACAAGAGG - Intergenic
1170443727 20:16403852-16403874 GGTTGGGGGTGAGGGAGCAATGG + Intronic
1170714990 20:18823743-18823765 GGTTAGGGGTGGGATTCAGAAGG + Intronic
1171171959 20:23023423-23023445 GGTGAGGGGTGGGGGACCGCAGG + Intergenic
1171885046 20:30645969-30645991 GGGTAGGGGTGGAAGAAAAAAGG - Intergenic
1172214550 20:33225755-33225777 GGTGTGTGGTGGAGGACAAAGGG - Intronic
1172526453 20:35602826-35602848 GGTTGGGGGTGGGGGAAGGAGGG - Intergenic
1172663607 20:36584190-36584212 GGTCAGGGGTGGGAGGAAAATGG - Intronic
1173166398 20:40689585-40689607 GGATGGGGGTGGGGTGCAAAGGG - Intergenic
1173632185 20:44524967-44524989 GGTCAGGGGCGGGGGTCACAAGG - Intergenic
1174736658 20:52972067-52972089 GGGAAGGGGTGCGGGAGAAAAGG - Intergenic
1175801052 20:61801155-61801177 GTTGAGGGCTTGGGGACAAAAGG + Intronic
1175995267 20:62809501-62809523 GGGTGTGGGTGGGGGACATAAGG - Intronic
1176133717 20:63509281-63509303 GGTTAGAGGTGGAGGAGGAATGG - Intergenic
1176358342 21:5971588-5971610 GGGGAGGGGGGGGGGACACAGGG - Intergenic
1176604313 21:8816313-8816335 GGTTAGGGGTTAGGGATAAGGGG + Intergenic
1176619313 21:9044002-9044024 GGTTAGGGGTTAGGGATAAGGGG + Intergenic
1176845206 21:13871375-13871397 GGGTAGGGGTGGAAGAAAAAAGG - Intergenic
1176849313 21:13900691-13900713 GGGTAGGGGTGGAAGAAAAAAGG - Intergenic
1177031465 21:15985089-15985111 GGGCAGGGGTGGGGGTCACAGGG + Intergenic
1177115996 21:17087979-17088001 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1177728378 21:24996403-24996425 TGTCAGGGGTGGGGGACTAGGGG - Intergenic
1177825787 21:26081398-26081420 GGGCAGGGGTGGGGGTCACAGGG + Intronic
1178067925 21:28926724-28926746 TGTTGGGGGTGGGGGGCAAGGGG + Intergenic
1178095693 21:29212551-29212573 GGCTAGGGGTGGGGGACGATGGG + Intronic
1178935391 21:36857586-36857608 GGTTTGGGGTGGGTGAACAAAGG - Intronic
1179765176 21:43566962-43566984 GGGGAGGGGGGGGGGACACAGGG + Intronic
1180285250 22:10739780-10739802 AGATAGGGGTGGGGGATGAATGG - Intergenic
1180346603 22:11707920-11707942 GGTTAGGGGTTAGGGATAAGGGG + Intergenic
1180354370 22:11826043-11826065 GGTTAGGGGTTAGGGATAAGGGG + Intergenic
1180363500 22:11919981-11920003 GGGTAGGGGTGGAAGAAAAAAGG + Intergenic
1180383884 22:12166312-12166334 GGTTAGGGGTTAGGGATAAGGGG - Intergenic
1181379135 22:22485841-22485863 GGTCAGGGGTGGAGGAACAAAGG + Exonic
1181681253 22:24497286-24497308 GACTAGGGGTGGGGTAGAAAGGG + Intronic
1181898572 22:26133041-26133063 TGTCAGGTGTGGGGGACTAAGGG - Intergenic
1182061939 22:27404651-27404673 GGGTAGGGCTGGGCCACAAAGGG + Intergenic
1182192716 22:28479743-28479765 AGTTAGGGGTAGGGGAGAATGGG - Intronic
1182422400 22:30254772-30254794 GGGTGGGGGTGGGGGACTTAGGG + Intergenic
1182835142 22:33335693-33335715 GGTTCGGGGTGTGGAACAGAAGG - Intronic
1182892991 22:33834476-33834498 TGGCAGGGGTGGGGGACACAAGG - Intronic
1183303108 22:37068166-37068188 GGTTAGGGGAAGGGTACATAAGG - Intronic
1183317133 22:37142922-37142944 GGTGTGGGGTGGGGGAAAATGGG - Intronic
1184240459 22:43208973-43208995 GGCTTGTGGTGGGGGACAGAAGG + Intronic
1184300552 22:43556212-43556234 GGTCAGGGGTGGGGGGAAATGGG + Intronic
1185319520 22:50194036-50194058 GGTTCGGTGTGGGGGACAGTGGG - Intronic
949203602 3:1411138-1411160 TGTTGGGGGTGGGGGACAAGGGG - Intergenic
949608589 3:5680629-5680651 GTTGGGGGGTGGGGGACAAGGGG + Intergenic
949807421 3:7970869-7970891 GGCTAGGAGTGGGGGACAGAAGG + Intergenic
950119998 3:10475420-10475442 GGTAAGGGGAGAGGGACAACTGG + Intronic
950233453 3:11296775-11296797 GGTAAGGGGTGGGGGAAGATGGG - Intronic
951459235 3:22931388-22931410 GTTGTGGGGTGGGGGACAAGGGG + Intergenic
952117516 3:30200531-30200553 GCCGGGGGGTGGGGGACAAAGGG - Intergenic
952239580 3:31516700-31516722 GGTTGGGGGGGGGGGGCAAGAGG - Intergenic
952645265 3:35649657-35649679 AGGCAGGGGTGAGGGACAAAGGG + Intronic
952647969 3:35685098-35685120 CATTAGGAGTGGGGGACAACTGG - Intronic
953069237 3:39502893-39502915 CCTTAGGGCTGGGGAACAAAAGG - Intronic
953479490 3:43238115-43238137 GGTTTGGGATGGGGGACATGTGG - Intergenic
954100205 3:48366544-48366566 GGTTAGGGGTGGTGGGGAGAAGG + Intergenic
954116683 3:48470489-48470511 GGTCAGAGGTGGGGGACCCAGGG - Intronic
955092995 3:55770791-55770813 TGTCAGGGGTGGGGGGCAAGGGG - Intronic
955188174 3:56734688-56734710 GGATAGGGGTGGGAGACCTATGG - Intronic
955424291 3:58771246-58771268 GTTGAGGGGTGGGGGACTAGGGG + Intronic
955586680 3:60485647-60485669 TGTTGGGGGTGGGGGGCAAGGGG + Intronic
956144621 3:66180308-66180330 TGGTAGGGGTTGGGGTCAAAGGG - Intronic
956368967 3:68537450-68537472 GGTTAGGGAAGGGAGAGAAAAGG + Intronic
956788441 3:72661746-72661768 GATTAGGTGAAGGGGACAAAGGG + Intergenic
956879695 3:73498330-73498352 GGTTAGTGTTGGGGGACAGTTGG + Intronic
957126921 3:76173508-76173530 TGTCAGGGGTGGGGGTCAAGGGG - Intronic
957161296 3:76612545-76612567 TGTTTGGGGTAGGGGACAAGGGG + Intronic
957247546 3:77733626-77733648 GGTATGGGCTGGGGGAGAAAGGG + Intergenic
958676966 3:97277317-97277339 GGGAAGGGGTGGGGGTCACAAGG + Intronic
959287899 3:104440116-104440138 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
959288717 3:104445530-104445552 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
959919825 3:111858299-111858321 GTTGGGGGGTGGGGGACAAGGGG + Intronic
960007287 3:112793443-112793465 GGGAAGGGGAGTGGGACAAAGGG - Intronic
960933165 3:122875355-122875377 TTTTAGGGGTGGGGGAGACAGGG + Intronic
963319449 3:143797732-143797754 GGGCAGGGGCGGGGGACACAAGG - Intronic
963399911 3:144785441-144785463 GTTTGGGGGTGGAGGACAAGGGG - Intergenic
963576048 3:147061561-147061583 GATCAGAGGTGGGAGACAAATGG - Intergenic
963638517 3:147829919-147829941 TGTCCGGGGTGGGGGACAAGGGG + Intergenic
964081146 3:152759561-152759583 GGTTAGGTATGAGGGACGAAGGG - Intergenic
965141911 3:164848826-164848848 GGTTATGGGAGGGGGAAAAGAGG + Intergenic
965447522 3:168793903-168793925 TGTTGGGGGTGGGGGTCAAGTGG + Intergenic
965888790 3:173483787-173483809 TCTTAGGGGTGTGGGCCAAATGG - Intronic
966055260 3:175679038-175679060 TGGTAGGGGTGGGGGTCACAAGG + Intronic
966632623 3:182095433-182095455 CTTGAGGGGTGGGGGACAAGGGG - Intergenic
966635807 3:182132201-182132223 GGGAAGGGGTGAGGGATAAAAGG - Intergenic
967909832 3:194533131-194533153 GGTTGGAGCTGGGGGACACATGG - Intergenic
968393085 4:208866-208888 GGTTTGGGGAGGAGGAAAAAAGG + Intergenic
968928450 4:3562539-3562561 GCGTGGGGGTGGGTGACAAATGG + Intergenic
969014847 4:4097142-4097164 CCTTGGGGGTGGGGGACAAGGGG + Intergenic
969134567 4:5019757-5019779 GGAGAGGGGTGGGGGATAAGAGG + Intergenic
969247086 4:5942141-5942163 GGTGTGGGGTGGGTTACAAATGG + Intronic
969374012 4:6751090-6751112 GGGTGGGGATGGGTGACAAACGG + Intergenic
969476894 4:7427009-7427031 GCTTAGTGGTGGGGGGCACAGGG + Intronic
969531728 4:7734180-7734202 GGGGACGGGTGGGGGACAGACGG + Intronic
969718124 4:8878140-8878162 GGGGAGGGGCGGGGGACAATGGG - Intergenic
970354580 4:15239192-15239214 TGTTTGGGTTGGGGGACAAATGG + Intergenic
970921036 4:21395422-21395444 GGAAAGGGGTGGGGGAGAAAAGG - Intronic
972090039 4:35269995-35270017 GGTGTGGGGTGGGGGGCAGAAGG - Intergenic
972299729 4:37773426-37773448 GGGTAGGGGTGGGGCAAACAGGG - Intergenic
972739602 4:41877812-41877834 GGGTGGGAGTGGGGGCCAAAAGG - Intergenic
973023743 4:45239063-45239085 GGGTGGGGGTGGGAAACAAATGG + Intergenic
973373806 4:49274636-49274658 GGTTAGGGGTTAGGGATAAGGGG - Intergenic
973383606 4:49335603-49335625 GGTTAGGGGTTAGGGATAAGGGG + Intergenic
973387211 4:49520616-49520638 GGTTAGGGGTTAGGGATAAGGGG + Intergenic
973835551 4:54805929-54805951 GGAAAGGGGTGAGGGATAAAAGG + Intergenic
974172902 4:58290926-58290948 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
974855423 4:67455130-67455152 TGTTGGGGGTGGGGGGCAAGGGG + Intergenic
975509116 4:75172868-75172890 GATTAGGGGTGGGGAAGAGAAGG - Intergenic
976448569 4:85160795-85160817 GTCTAGGGGTGGGGGACTAGGGG - Intergenic
976549135 4:86374252-86374274 TGTTGGGGGTGGGGGACTAGGGG + Intronic
976695702 4:87917941-87917963 GGGCAGGGGTGGGGGACACAAGG - Intergenic
976739388 4:88343004-88343026 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
977074286 4:92433210-92433232 GGTTGGGGGAGGGTGACACAAGG + Intronic
978454257 4:108870343-108870365 GGTATTGGGTGGGGAACAAAAGG + Intronic
978585707 4:110273775-110273797 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
978821533 4:112972339-112972361 GTTGAGGGGTGAGGGGCAAAGGG - Intronic
979063845 4:116101483-116101505 GATTGGGGTTGGGGGAGAAAGGG - Intergenic
979170802 4:117599451-117599473 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
979895458 4:126150298-126150320 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
980317097 4:131216557-131216579 TGTTGGGGTTGGGGGACAAGGGG - Intergenic
980349272 4:131666173-131666195 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
980865834 4:138552878-138552900 GTTGAGGGGTGGGGGGCAAGGGG + Intergenic
981043163 4:140241867-140241889 GGTTTGGGGTGGGCTACAACAGG - Intergenic
981294410 4:143114715-143114737 GTTGCGGGGTGGGGGACAAGGGG + Intergenic
981735053 4:147940535-147940557 GTTTTGGGGTGGGGGAGAAGTGG - Intronic
982045810 4:151444510-151444532 GGGAGTGGGTGGGGGACAAAAGG - Intronic
982056208 4:151551182-151551204 GGGTAGGGGAAGTGGACAAAAGG + Intronic
982401251 4:154970549-154970571 GGGGAGGGGTTGGGGAGAAAAGG + Intergenic
982494164 4:156069005-156069027 GGCTAAGTGTGGGGGAGAAATGG + Intergenic
982539635 4:156651935-156651957 GTTGTGGGGTGGGGGACAAGGGG + Intergenic
982645615 4:158021597-158021619 GGTGAGAGGTGGGTGACTAAAGG + Intergenic
983056602 4:163104075-163104097 GGGTAGGGGTGGGGGTCCCAAGG + Intergenic
983759656 4:171389085-171389107 GTTAGGGGGTGGGGGGCAAAGGG + Intergenic
983904300 4:173168725-173168747 CGGTAGGGGTGGGGGAAAGAGGG + Intergenic
984558732 4:181243017-181243039 TGTTGGGGGCGGGGGACAAAGGG + Intergenic
984700260 4:182814533-182814555 GGGCAGGGGTGGGGGTCACAGGG - Intergenic
986028658 5:3874587-3874609 AGTTAGGGGTGAGGGGGAAAGGG + Intergenic
986366238 5:7035085-7035107 TGTCAGGGATGGGGGACAATAGG - Intergenic
986415307 5:7522335-7522357 GGCTAGGGGTTGGGGAAAATGGG - Intronic
986682405 5:10246083-10246105 GCTTAGGGCTGGGGGATAGAGGG - Intronic
987514862 5:18892187-18892209 GTTAGGGGGTGGGGGACCAAGGG + Intergenic
989661037 5:43797974-43797996 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
991029827 5:62071254-62071276 GGGTAGGGGTGGGGGCCAAGGGG + Intergenic
992091940 5:73325113-73325135 GAATGGGGGTGGGGGAGAAATGG - Intergenic
992328008 5:75683120-75683142 GGTTAGGAGTTGGGGAGAAGAGG + Intronic
992603175 5:78425941-78425963 TGTCAGGGGTGGGGGGCAAGGGG - Intronic
992876255 5:81059029-81059051 GGGTAGGGGTGGAGCACAAGAGG - Intronic
992976330 5:82124444-82124466 GTTTGGGGGTGGGGGACAATGGG - Intronic
992993803 5:82313044-82313066 GGTAGGAGGTGGGGGACACAGGG - Intronic
993243903 5:85426898-85426920 AGTTGGGGGTGGGGGAAAAAGGG + Intergenic
994015602 5:94961268-94961290 GTTGGGGGGTGGGGGACAAGGGG + Intronic
994044904 5:95296537-95296559 GGTTAGGGATGGGGGATGAGGGG - Intergenic
994325498 5:98441128-98441150 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
994403845 5:99318229-99318251 GGTGAGGGGTCGGGGTGAAAAGG - Intergenic
994475522 5:100263765-100263787 GGTTAGGGATGGTGGGGAAAAGG - Intergenic
994654566 5:102574870-102574892 GGTTGGGGGTGGGGGAAATGGGG - Intergenic
994978119 5:106837858-106837880 TGTTGGGGGTGGGGGACTAGGGG - Intergenic
995775606 5:115722003-115722025 GGTTAGGCATGAGGGATAAAAGG - Intergenic
995997001 5:118312563-118312585 TGTCAGGGGTGGGGGGCAAGGGG - Intergenic
996168126 5:120251769-120251791 GGATAAGGGAGGGTGACAAAAGG + Intergenic
996443730 5:123519727-123519749 GGTAAGGGGTTGGGGAGGAAGGG + Intronic
996480322 5:123968722-123968744 GGTTAGGGCTGGTGGGAAAAGGG - Intergenic
996938698 5:128977463-128977485 GGAAAGGGGTGGGGGAACAAGGG + Intronic
996974895 5:129420065-129420087 TGTAGGGGGTGGGGAACAAATGG + Intergenic
997001014 5:129762009-129762031 TGTGAGGGGTGGGGGACAAGGGG + Intronic
997112981 5:131095576-131095598 TGTCAGGGGTGGGGGGCAAGGGG - Intergenic
997219728 5:132151238-132151260 AGTCAGGGGTGGGGGACTAGGGG - Intergenic
997418481 5:133747860-133747882 GGTGATGGGTGGGGATCAAATGG + Intergenic
997457725 5:134029749-134029771 GGTTAGGGATGGTGGGAAAAGGG + Intergenic
997519637 5:134514537-134514559 GGTTGGGGGTAGGGGAGAAGTGG - Intergenic
997678254 5:135731185-135731207 TGGTAGGGGTGGGGGTCATAAGG + Intergenic
997769397 5:136541131-136541153 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
997788625 5:136737223-136737245 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
999455236 5:151709747-151709769 GGCGGGGGGTGGGGGATAAATGG + Intergenic
999748455 5:154609345-154609367 GGTTGGGGTTGGGGGATAGAGGG + Intergenic
999779541 5:154838013-154838035 GTTTAGGGGTGGCTGACACATGG - Intronic
999827788 5:155290640-155290662 GGTTGGGGGTGGAGGGGAAATGG + Intergenic
999866757 5:155709048-155709070 GTCAAGGGGTGGGGGACAAGGGG - Intergenic
1000291168 5:159872920-159872942 GTTTGGGGGTGGGGGGCAAGGGG - Intergenic
1000397354 5:160789829-160789851 GGTTGGGGATGGGGAACCAAAGG + Intronic
1000884973 5:166740224-166740246 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1001146332 5:169187893-169187915 GGTGAGTGGTGAGGGACACATGG - Intronic
1001579272 5:172787940-172787962 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1001629181 5:173161783-173161805 GGTTATGGGTGGTGGACACATGG + Intronic
1001763175 5:174224020-174224042 GGTTTGGGCTGGGGGACAGGGGG + Intronic
1001873416 5:175178458-175178480 AGTTATGGGAGGGGGAGAAAAGG + Intergenic
1002079763 5:176730387-176730409 GGATGGGGGTGGGGGACAGGGGG + Intergenic
1002473771 5:179452643-179452665 GGACAGGGTTGGGGGGCAAAGGG - Intergenic
1002668139 5:180842193-180842215 GGTAAGGAGTAGGGGACAAAAGG + Intergenic
1003045484 6:2729545-2729567 GTTTAGGGTTGGGGAACTAAGGG - Intronic
1003429714 6:6027991-6028013 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1003430544 6:6033371-6033393 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1003979004 6:11371742-11371764 GGTAAGGGCTGGAGGACACAGGG - Intronic
1004057477 6:12154635-12154657 TGTTGGGGGTGGGGGACAAGGGG + Intronic
1004107084 6:12675908-12675930 GGTGAGGGATGGAGGGCAAATGG + Intergenic
1004366707 6:15019084-15019106 GGCTGGGGGTGGGGGAGAATAGG + Intergenic
1006017675 6:31095127-31095149 TTTTGGGGGTGGGGGACACATGG + Intergenic
1006104931 6:31710741-31710763 GGGGAGGGGTGGGGGACTGAAGG + Intronic
1006502354 6:34466726-34466748 GGGAAGGGGTAGGGGACAGAAGG - Intronic
1007059227 6:38921943-38921965 GGGCAGGGGTGGGGGTCACAAGG + Intronic
1007168921 6:39848585-39848607 GCCTAGGGGTGGGAGACACAGGG - Intronic
1007301101 6:40868521-40868543 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1007412511 6:41673286-41673308 GGAAAGGGGTGGGGGACAGAGGG - Intergenic
1007515062 6:42404476-42404498 GGGTGGGGGTAGGGGAGAAAAGG - Intronic
1007853958 6:44834874-44834896 GGTTAGGGGAGGGGGAAGGAAGG + Intronic
1007867807 6:44992728-44992750 GTCCAAGGGTGGGGGACAAATGG + Intronic
1007947807 6:45841471-45841493 GGGTCGGGGTGGGGGAAGAAGGG + Intergenic
1008029956 6:46684509-46684531 AGTTAGGGATGGGGAAGAAAAGG - Intergenic
1008548626 6:52605866-52605888 GGGGAGGGGAGGGGAACAAAAGG - Intergenic
1010840817 6:80647721-80647743 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1010893972 6:81344114-81344136 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1011354352 6:86458645-86458667 GGGCAGGGGTGGGGGACACAAGG - Intergenic
1011735637 6:90308176-90308198 GCCGAGGGGTGGGGGCCAAAGGG + Intergenic
1011834715 6:91417532-91417554 GGTTATGTGTTGGGCACAAAGGG + Intergenic
1012066071 6:94554105-94554127 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1012066875 6:94559347-94559369 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1012191435 6:96285112-96285134 GGTTATGGGAGGGGGAAAATAGG + Intergenic
1012664412 6:101949504-101949526 GGTTGGGGATGGGGGACTAGGGG - Intronic
1012963967 6:105652879-105652901 GCTTAGGGGTGGGGGAAATCAGG - Intergenic
1013576993 6:111493754-111493776 GTTGGGGGGTGGGGGACAAGGGG - Intergenic
1013697062 6:112716039-112716061 TGTTAAGGGTGGGGGACCATAGG + Intergenic
1014499061 6:122163760-122163782 GGTAAGGGGTGGGGGAGAAATGG + Intergenic
1014671335 6:124308136-124308158 GCTGCGGGGTGGGGGGCAAAGGG - Intronic
1014693388 6:124589822-124589844 GTTGGGGGGTGGGGGGCAAAAGG - Intronic
1014718259 6:124890630-124890652 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1014719354 6:124897553-124897575 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1014859080 6:126441586-126441608 GGAGAGGGGTGAGGGACAAAAGG - Intergenic
1015162618 6:130170193-130170215 TGTTGGCGGTGGGGGACAAGGGG - Intronic
1015206074 6:130640293-130640315 GTTGTGGGGTGGGGGACAAGGGG + Intergenic
1015267669 6:131305089-131305111 GGGTTGGGGTGGGGGAGAAAGGG - Intergenic
1015435180 6:133178068-133178090 GGTGAGGGGTGGGGGGCTAGAGG - Intergenic
1015571865 6:134630165-134630187 GCTGAGGGGTGGGGGGCAAGGGG - Intergenic
1015897169 6:138028616-138028638 GGGTAGGGGTAGGAGGCAAATGG - Intergenic
1016518455 6:144923398-144923420 GGGTAGGGGCGGGGGTCACAAGG - Intergenic
1017065318 6:150523588-150523610 GTCTGGGGGTGGGGGACAAGGGG + Intergenic
1017236048 6:152118609-152118631 GGTAAGGGGTGGGGGGCAAGGGG + Intronic
1017920792 6:158870224-158870246 AGTTGTGGGTGGGGGACAGAAGG + Intronic
1018077286 6:160228841-160228863 GGGCAGGGGTGGGGGACACAAGG - Intronic
1018542527 6:164898035-164898057 CTTTGGGGGTGGGGGAAAAAAGG - Intergenic
1018815980 6:167331397-167331419 GGTTAGGAGGAGGGGACATAGGG - Intronic
1018948532 6:168363940-168363962 GGTGAGGGGTGAGGGGCAAAGGG - Intergenic
1019963626 7:4481745-4481767 GTTGGGGGGTGGGGGACAAGAGG + Intergenic
1020066794 7:5194402-5194424 GATTAGGGAAGGGGGAGAAAAGG + Intronic
1020098453 7:5381211-5381233 GCGCAGGGGTGGGGGACAGAGGG - Intronic
1020350079 7:7209938-7209960 GGGCAGGGGCGGGGGACACAAGG + Intronic
1020542086 7:9470848-9470870 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1020741276 7:12021813-12021835 GGTTAGGCTCAGGGGACAAATGG + Intergenic
1021550683 7:21868052-21868074 GGGCAGGGGTGGGGGTGAAAGGG - Intronic
1022147118 7:27555556-27555578 GGAGAGGGTAGGGGGACAAAAGG - Intronic
1022209332 7:28193581-28193603 GGGTGGGGGTGGGGGAAAGAGGG - Intergenic
1022380918 7:29859283-29859305 GGTTTGAGGTTTGGGACAAAAGG + Intronic
1022441545 7:30437219-30437241 TGTTGGGGGTGGGGGGCAAGGGG + Intronic
1022501174 7:30883230-30883252 GGTTGGGGGTGGGGGCTAAATGG + Intronic
1022759572 7:33333189-33333211 GGAGAGGGGTGAGGGACAAAAGG - Intronic
1023557506 7:41438430-41438452 GGTTGGGGGTGGGTGAGAAGGGG + Intergenic
1023958106 7:44904027-44904049 GGCTAGGGGCAGGGGAAAAAGGG - Intergenic
1024205681 7:47158227-47158249 GTTTGGGGGTGGGGGGCAAGGGG + Intergenic
1024336736 7:48215756-48215778 GGTTAGGCGTGGGGGAGATTGGG - Intronic
1024697245 7:51870123-51870145 GGGTAGGAGTGGGGGTCACAAGG - Intergenic
1024813416 7:53239410-53239432 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1024972348 7:55082331-55082353 GGGCAGGGGTGGGGTACAGAGGG - Intronic
1025029719 7:55547219-55547241 GGCTGGGGACGGGGGACAAAGGG + Intronic
1025119325 7:56287126-56287148 GGTTAGGGGTGGGAGCGAAAAGG + Intergenic
1026004924 7:66592887-66592909 AGGTAGGGGCGGGGGACACAAGG - Intergenic
1026201514 7:68218479-68218501 GGGCAGGGGTGGGGGTCATAAGG + Intergenic
1026359955 7:69594502-69594524 GTTGAGGGGTGGGGGGCAAGGGG - Intergenic
1027157466 7:75779102-75779124 GGGCAGGGGTGGGGGACACAAGG - Intronic
1027158934 7:75788355-75788377 GGGCAGGGGTGAGGGACACAAGG - Intronic
1027232422 7:76280560-76280582 GGTGGGGGGCGGGGGCCAAAGGG - Intronic
1027535077 7:79389745-79389767 GGGTAGGGGAAGGGGAGAAATGG + Intronic
1027864031 7:83623870-83623892 TGTTGGGGGTGGGGGGCAAGGGG - Intronic
1027928367 7:84497419-84497441 TTTTGGGGGTGGGGGACAGAGGG + Intergenic
1028260492 7:88658442-88658464 GGTTAAGGGTGGGATAAAAAAGG + Intergenic
1028374014 7:90126057-90126079 GGGTGGGGGTGGGGGGCAAGGGG + Intergenic
1028985085 7:97003233-97003255 TGTGGGGGGTGGGGGACAGAAGG - Intergenic
1029500717 7:100927795-100927817 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1029516585 7:101027252-101027274 GGTTGGGGGTGGGGCACCTAGGG + Intronic
1029571736 7:101374312-101374334 AGTTAGGGGTGGGGCAAACAAGG - Intronic
1029612048 7:101631603-101631625 GGTTAGGGGTGAGGGTTGAAAGG - Intergenic
1029926584 7:104325818-104325840 GTTGGGGGGTGGGTGACAAAGGG + Intergenic
1030127250 7:106165966-106165988 GGTTGGGGGTGGGGGAGCGATGG - Intergenic
1030537133 7:110782465-110782487 TGGTAGAGGTGGGGGACAGATGG + Intronic
1030626467 7:111850722-111850744 GGGCAGGGGTGGGGGTCACAAGG - Intronic
1031039242 7:116821642-116821664 GTTTAGGGGTGGGGGGCAAGGGG - Intronic
1031856420 7:126928221-126928243 GGTGGGGGGTGGGGGGCAAGGGG + Intronic
1032044742 7:128595639-128595661 GGTTTCGGGTGGGGAACAGAAGG - Intergenic
1032231932 7:130081956-130081978 GGTAGGGGGTGGGAGACAACAGG - Intronic
1032798366 7:135297280-135297302 GTTGGGGGGTGGGGGGCAAAGGG + Intergenic
1032839774 7:135704505-135704527 GGTTAGGGGAGGAGGAGAAGAGG + Intronic
1033433447 7:141310571-141310593 GTTGAAGGGTGGGGGACAAGGGG - Intronic
1033477983 7:141709104-141709126 AGTAAGGGGTGGGGGAAAAAGGG + Intronic
1034017373 7:147601384-147601406 GGGCAGGGGTGGGGGACACAAGG + Intronic
1034691914 7:153020910-153020932 GTTGGGGGGTGGGGGACAAGGGG - Intergenic
1034791845 7:153977702-153977724 TGTCGGGGGTGGGGGACAAGGGG - Intronic
1034954745 7:155327569-155327591 GGTCAGGGTTGGGGGAGAGAGGG - Intergenic
1035022904 7:155809467-155809489 AGTTAAGGGTGGGGGAGGAAGGG - Intronic
1035024072 7:155815131-155815153 GGTGCGGGGAGGGGGCCAAATGG - Intergenic
1035566649 8:645562-645584 GGTCAGGGCTGGGGGAACAATGG - Intronic
1035782812 8:2242271-2242293 TGTTGGAGGTGGGGGACAAGGGG + Intergenic
1035809318 8:2477314-2477336 TGTTGGAGGTGGGGGACAAGGGG - Intergenic
1035827810 8:2663305-2663327 TGTTGGCGGTGGGGGACAAGGGG - Intergenic
1036065240 8:5373145-5373167 GGTGAGGGGAGGGGGACACTGGG + Intergenic
1036244173 8:7102516-7102538 CGTCGGGGGTGGGGGACAAGGGG - Intergenic
1036638888 8:10569762-10569784 GGTGAGGGGTGGGAGAGAGAAGG + Intergenic
1037359126 8:18054408-18054430 GACTTGGGGTGGGGGGCAAATGG - Intergenic
1038341368 8:26688696-26688718 GTCGAGGGGTGGGGGACAAGGGG - Intergenic
1038352384 8:26789097-26789119 TGTCAGGGGTGGGGGGAAAAGGG - Intronic
1038750811 8:30294059-30294081 GGAGAGGGGTGAGGGATAAAAGG + Intergenic
1039521275 8:38174435-38174457 TGTTAGGGTTGGGGAGCAAAGGG + Intronic
1041282857 8:56229033-56229055 CGTTAGGGGTGGGGAATAAAGGG + Intergenic
1042705192 8:71659476-71659498 GGTTTGGGGTGGGGGAAAAATGG + Intergenic
1042888436 8:73578964-73578986 GGGTAGGGGTGGGAGATAGAAGG - Intronic
1042993066 8:74662431-74662453 GCTGAGGGGTGGGGGGCAAGGGG + Intronic
1042995006 8:74687672-74687694 GGTTGGGGGTGAGGGAAATAGGG + Intronic
1043161995 8:76856989-76857011 GGCTAGGGGTGAGGGAATAAAGG - Intronic
1043353989 8:79391440-79391462 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1043463696 8:80486006-80486028 GCCGAGGGGTTGGGGACAAAAGG - Intronic
1043641580 8:82458143-82458165 GTTGTGGGGTGGGGGACAAAGGG - Intergenic
1043717394 8:83504879-83504901 GGTCAGGAGTGGGGGTCACAAGG + Intergenic
1043729162 8:83652280-83652302 GGCTAGGGGGAGGGGACAATGGG + Intergenic
1043837185 8:85061280-85061302 GGTGAGGGGTGGGTGGCAAGGGG + Intergenic
1044229182 8:89756068-89756090 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1044248360 8:89977215-89977237 GTTTGGGGGTGGGGGACAAGGGG - Intronic
1045066055 8:98445782-98445804 GGTTAGGTGTTGGGGAAAAAGGG - Intronic
1045252830 8:100495827-100495849 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1045368364 8:101496569-101496591 TGTTGGGGGTGGGGGAAAAGGGG + Intronic
1045399666 8:101800890-101800912 GGAGAGGGGAGGGGGAAAAAAGG + Intronic
1045742736 8:105381071-105381093 GTTGAGGGGTGGGGGGCAAGGGG - Intronic
1045965675 8:108021771-108021793 GGGCAGGGGTTGGGGACAAGGGG + Intronic
1047325483 8:123831764-123831786 GGTTAGGGGAGGGGAAGACAAGG - Intergenic
1047702016 8:127458113-127458135 AGTTGGGGGTGGGGGAGGAATGG + Intergenic
1047732692 8:127739229-127739251 CCTGAGGGGTGGGAGACAAACGG - Intronic
1047736905 8:127773742-127773764 TGTCGGGGGTGGGGGACAAGGGG + Intergenic
1048109456 8:131451996-131452018 GTTGGGGGGTGGGGGACTAAAGG + Intergenic
1048336806 8:133508453-133508475 GGGAAAGGGTGGGGGACACAGGG - Intronic
1048584976 8:135767377-135767399 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1048601509 8:135923618-135923640 GCTCAGGGGAGGTGGACAAAAGG - Intergenic
1048898575 8:139016506-139016528 GGTGAGGGATGGGTGACTAATGG + Intergenic
1049296877 8:141845479-141845501 GGGGTGGGGTGGGGGAGAAATGG - Intergenic
1049970973 9:821639-821661 GGTTAGGGGTTGAGGGGAAATGG - Intergenic
1050972799 9:11897880-11897902 TGTCAGGGGTGGGGGCCAAGGGG + Intergenic
1051125465 9:13798507-13798529 GTTGAGGGGTGGGGGACTGAGGG + Intergenic
1052203410 9:25809591-25809613 GTTGAGGGGTGGGGGGCAAGGGG - Intergenic
1052614298 9:30818385-30818407 GTTGTGGGGTGGGGGGCAAAGGG + Intergenic
1052661655 9:31440541-31440563 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1052859258 9:33426856-33426878 GGTTGGAGGTGGTTGACAAAGGG + Intergenic
1052881647 9:33604272-33604294 GGTTGAAGGTGGGGGAGAAAAGG - Intergenic
1053033320 9:34801904-34801926 TGTTGGGGGTGGGGGGCAAGGGG + Intergenic
1053078010 9:35151409-35151431 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1053078744 9:35156422-35156444 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1053170429 9:35876172-35876194 GGTGAGGGGTGGGGGAGTAAAGG - Intergenic
1053494671 9:38541565-38541587 GGTTGAAGGTGGGGGAGAAAAGG + Intronic
1053803333 9:41777681-41777703 GCGTGGGGGTGGGTGACAAATGG + Intergenic
1054141929 9:61537443-61537465 GCGTGGGGGTGGGTGACAAATGG - Intergenic
1054191625 9:61988991-61989013 GCGTGGGGGTGGGTGACAAATGG + Intergenic
1054461689 9:65468621-65468643 GCGTGGGGGTGGGTGACAAATGG - Intergenic
1054646746 9:67598721-67598743 GCGTGGGGGTGGGTGACAAATGG - Intergenic
1054971591 9:71094087-71094109 GGGTGGGGGTGGGGGGCAAGGGG + Intronic
1055032550 9:71785076-71785098 AGTCAGGGGTGGGGGGCAAGGGG + Intronic
1055062020 9:72078808-72078830 GTCAAGGGGTGGGGGACAAGGGG + Intergenic
1055675717 9:78658206-78658228 GGAGAGAGGTGGGGGACAAGGGG - Intergenic
1055807020 9:80107196-80107218 GGATAAGGGTGGGTGGCAAACGG + Intergenic
1055970300 9:81905249-81905271 GGTTAGGGATGGGGGATATTGGG + Intergenic
1055972496 9:81925696-81925718 GGTTAGGGGTGGAGGATATTGGG + Intergenic
1055974249 9:81940768-81940790 GGTTAGGGGTGGAGGATATTGGG + Intergenic
1056704391 9:88939740-88939762 GGAGAGGGGTGAGGGATAAAAGG - Intergenic
1056824321 9:89866078-89866100 GGGTAGAGGTGGGGTACACATGG - Intergenic
1057813403 9:98275091-98275113 GGGCAGGGGCGGGGGACACAAGG + Intergenic
1058829695 9:108804901-108804923 TGTTAGGGGTGGGGGGAAAGGGG + Intergenic
1058934939 9:109761520-109761542 TGTTGGGGGTGGGGGACAAGGGG - Intronic
1059059893 9:111024695-111024717 GTTGGGGGGTGGGGGACAAGGGG - Intronic
1059099720 9:111458602-111458624 GATTAGGGGAGGTGGACAAGGGG + Intronic
1059160699 9:112032304-112032326 AGTTAGGGGTTGGGGAGGAATGG + Intergenic
1059230552 9:112717732-112717754 GGTTAGGACTGGAGGACAACAGG + Intronic
1059347107 9:113636440-113636462 GGTTAGGGGTGTGGCAGAGATGG + Intergenic
1059660374 9:116394189-116394211 GGTGGGCGGTGGGGGACAATAGG + Intronic
1059677062 9:116549641-116549663 GGTTAGGTGTAGGAAACAAATGG + Intronic
1059729130 9:117039424-117039446 TGTTGGGGGTTGGGGAGAAAGGG + Intronic
1060013993 9:120070365-120070387 GGTTAGGGGTGAGGGATGGAAGG + Intergenic
1060062396 9:120472511-120472533 AGTTAAGGGTGGGGGACAGGTGG + Intronic
1060119210 9:120972527-120972549 GGTTTGGGGTGGGGTACCAGGGG - Intronic
1061086888 9:128404770-128404792 GGTTGGGTGGGGGGGACCAAGGG + Intergenic
1061295916 9:129676685-129676707 GGTTAGTGGTGGGGGCCTCAAGG - Intronic
1061445612 9:130635657-130635679 GGGTGGGGGTGGGGGAGAAGGGG - Intronic
1061920831 9:133781482-133781504 GGTCAGGGGTGGGGGGCAGCTGG + Intronic
1062353099 9:136148662-136148684 GGGAAGGGGTGGGGGAAAGAGGG + Intergenic
1062695479 9:137873664-137873686 GGATGGGGGTGGGGGACAGGGGG + Intergenic
1203697503 Un_GL000214v1:112609-112631 GGTTAGGGGTTAGGGATAAGGGG - Intergenic
1203731610 Un_GL000216v2:96836-96858 AGATAGGGGTGGGGGATGAATGG - Intergenic
1203546553 Un_KI270743v1:132655-132677 GGGTAGGGGTGGAAGAAAAAAGG - Intergenic
1203551707 Un_KI270743v1:168403-168425 GGTTAGGGGTTAGGGATAAGGGG + Intergenic
1185755613 X:2650835-2650857 GGTCTGGAGTGGGGGCCAAAGGG - Intergenic
1186112392 X:6272404-6272426 GGTCAGGAGTGGGGGTCACAAGG + Intergenic
1186113241 X:6277719-6277741 GGTCAGGAGTGGGGGTCACAAGG + Intergenic
1186195988 X:7110754-7110776 GGGCAGGGGTGGGGGTCACAAGG + Intronic
1186333189 X:8558167-8558189 TGTTGGGGGTGGGGGGCAAGGGG + Intronic
1186631707 X:11356258-11356280 TGTTGGGGGTGGGGGACAAGGGG + Intronic
1186700747 X:12087241-12087263 GGTTGGGGGTGGGAGAGGAATGG + Intergenic
1187804560 X:23104622-23104644 TGTCGGGGGTGGGGGGCAAAGGG + Intergenic
1187842734 X:23505770-23505792 GGTTATGGGAGGGGGAGAAGAGG - Intergenic
1188059027 X:25577529-25577551 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1188263379 X:28042186-28042208 GGTTGGGGGTGGGGGCGTAAGGG + Intergenic
1188419196 X:29975738-29975760 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1188430738 X:30103805-30103827 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1188474341 X:30574197-30574219 GGTTATGGGTGGTGGACCAGAGG - Intronic
1188598191 X:31926908-31926930 GGGTAGGGCTGGAGGACACAGGG + Intronic
1189320002 X:40082218-40082240 GGTTGGGGGTGGGGAAGGAAAGG - Intronic
1189369430 X:40416089-40416111 GGGGAGGGGTGTGGGACAAGGGG - Intergenic
1189440939 X:41035297-41035319 TGTCAGGGGTGGGGGACAGAGGG + Intergenic
1189996234 X:46641360-46641382 TTTGAGGGGTGGGGGAGAAAAGG + Intronic
1190780250 X:53586980-53587002 GGATAGGGGAGGGGAACATAAGG + Intronic
1190833207 X:54077828-54077850 GCTAAGGGGTGGGGGAAGAAGGG - Intronic
1191104630 X:56764809-56764831 GGGTAGGGGTGGGGGCCACAGGG + Intergenic
1191173428 X:57474354-57474376 TGTTGGGGGCGGGGGACAAGGGG - Intronic
1191806326 X:65138236-65138258 GGTTAGGGGTGGAGGGGAAAGGG - Intergenic
1191826098 X:65365804-65365826 GGACAGGGGTGGGGGTCACAAGG - Intergenic
1192302759 X:69923284-69923306 GTTTGGGGGTGGGGGGCAAGGGG - Intronic
1192637553 X:72833632-72833654 TGTTGGGGGTGGGGGGCAAGGGG + Intronic
1192644161 X:72887182-72887204 TGTTGGGGGTGGGGGGCAAGGGG - Intronic
1192706690 X:73533739-73533761 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1192730891 X:73801645-73801667 GGGCAGGGGTGGAGGACACAAGG + Intergenic
1192859297 X:75048545-75048567 GGATGGGGGTGGGGGATATATGG + Intergenic
1192863279 X:75102322-75102344 GGTTAGGAGTGGGGGATAGAGGG - Intronic
1192963700 X:76155448-76155470 TGTCGGGGGTGGGGGACAAGGGG + Intergenic
1193056288 X:77154713-77154735 TTTTGGGGGTGGGGGACAAGGGG + Intergenic
1193072235 X:77318492-77318514 GTTGAGGGGTGGGGGAAAAGAGG + Intergenic
1193159209 X:78208808-78208830 GGTTGGGGGTGGGGGGCTATGGG + Intergenic
1193801487 X:85942258-85942280 GGTTGGGGGTTGGGGGCTAAGGG - Intronic
1194139564 X:90193229-90193251 GTCTAGGGGTGGGGGACTAGGGG - Intergenic
1194199205 X:90934321-90934343 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1194623244 X:96198364-96198386 GTTAGGGGGTGGGGGACAAAGGG + Intergenic
1194642980 X:96425743-96425765 GTTGGGGGGTGGGGGGCAAAGGG - Intergenic
1194744990 X:97618492-97618514 GGTCAGGGGAGGGGGAGAAATGG - Intergenic
1195143660 X:101990247-101990269 GATTGGGGTTGGAGGACAAATGG - Intergenic
1195355388 X:104034739-104034761 TGTCAGGGCTGGGGGACAAGGGG - Intergenic
1196196224 X:112840828-112840850 AGGTAGGGGAGGGGGACGAACGG + Intergenic
1196226674 X:113176374-113176396 GGGCAGGGGTGGGGGTCACAAGG + Intergenic
1196308543 X:114133337-114133359 GGAGGGGGGTGAGGGACAAAAGG + Intergenic
1196496723 X:116332193-116332215 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1196854932 X:119973851-119973873 GGCTGGGGATGGGGGAGAAAAGG + Intergenic
1196857337 X:119996581-119996603 GGCTGGGGATGGGGGAGAAAAGG + Intergenic
1196975354 X:121152824-121152846 GGTAAGGAGGAGGGGACAAAGGG - Intergenic
1197204407 X:123777487-123777509 TGGCAGGGGTGGGGGACACAAGG - Intergenic
1197243838 X:124147982-124148004 GTTGAGGGGTGGGGGACTAGGGG + Intronic
1197433541 X:126396826-126396848 GAATGGGGGTGGGAGACAAAGGG - Intergenic
1197500285 X:127232820-127232842 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1198249419 X:134865799-134865821 GGTTAGGGGTGGCGGATATCTGG + Intergenic
1198644092 X:138787704-138787726 GTTGGGGGGTGGGGGGCAAAGGG - Intronic
1198664063 X:139002565-139002587 GCTTGGGGTTGGGGGACAAGTGG - Intronic
1198748351 X:139913637-139913659 CGGTAGGGGCGGGGGACACAAGG - Intronic
1199052039 X:143247029-143247051 GGTTGAGGGTGGAGGAAAAATGG + Intergenic
1199256680 X:145725789-145725811 GGGCAGGGGCGGGGGACACAAGG - Intergenic
1199377536 X:147131858-147131880 GGGCAGGGGTGGGGGACACAAGG + Intergenic
1200061352 X:153485179-153485201 GGTTAGGGCTGGGGGACCCTGGG - Intronic
1200171190 X:154076354-154076376 GGTTAGGGGAGAGTGGCAAAGGG - Intronic
1200485307 Y:3762178-3762200 GTCTAGGGGTGGGGGACTAGGGG - Intergenic
1200806594 Y:7439807-7439829 GGGAAGGGGTGAGGGATAAAAGG + Intergenic
1200942622 Y:8801579-8801601 GGGCAGGGGTGGGGGTCACAAGG - Intergenic
1201152979 Y:11103991-11104013 GGTTAGGGGTTAGGGATAAGGGG + Intergenic
1201365881 Y:13205597-13205619 AGGCAGGGGTGGGGGTCAAAAGG + Intergenic