ID: 907692902

View in Genome Browser
Species Human (GRCh38)
Location 1:56688232-56688254
Sequence GGGACAAAGGGAAATTTTAT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907692899_907692902 -4 Left 907692899 1:56688213-56688235 CCATTGTGGTTAGGGGTGGGGGA No data
Right 907692902 1:56688232-56688254 GGGACAAAGGGAAATTTTATTGG No data
907692895_907692902 -2 Left 907692895 1:56688211-56688233 CCCCATTGTGGTTAGGGGTGGGG 0: 1
1: 1
2: 1
3: 19
4: 204
Right 907692902 1:56688232-56688254 GGGACAAAGGGAAATTTTATTGG No data
907692886_907692902 10 Left 907692886 1:56688199-56688221 CCTTTGTCCCTACCCCATTGTGG No data
Right 907692902 1:56688232-56688254 GGGACAAAGGGAAATTTTATTGG No data
907692884_907692902 28 Left 907692884 1:56688181-56688203 CCTTCTGAAATTTGTTTCCCTTT 0: 1
1: 0
2: 1
3: 81
4: 721
Right 907692902 1:56688232-56688254 GGGACAAAGGGAAATTTTATTGG No data
907692885_907692902 11 Left 907692885 1:56688198-56688220 CCCTTTGTCCCTACCCCATTGTG No data
Right 907692902 1:56688232-56688254 GGGACAAAGGGAAATTTTATTGG No data
907692892_907692902 2 Left 907692892 1:56688207-56688229 CCTACCCCATTGTGGTTAGGGGT No data
Right 907692902 1:56688232-56688254 GGGACAAAGGGAAATTTTATTGG No data
907692897_907692902 -3 Left 907692897 1:56688212-56688234 CCCATTGTGGTTAGGGGTGGGGG No data
Right 907692902 1:56688232-56688254 GGGACAAAGGGAAATTTTATTGG No data
907692890_907692902 3 Left 907692890 1:56688206-56688228 CCCTACCCCATTGTGGTTAGGGG 0: 1
1: 0
2: 0
3: 5
4: 79
Right 907692902 1:56688232-56688254 GGGACAAAGGGAAATTTTATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907692902 Original CRISPR GGGACAAAGGGAAATTTTAT TGG Intronic
No off target data available for this crispr