ID: 907695253

View in Genome Browser
Species Human (GRCh38)
Location 1:56719595-56719617
Sequence AACTGATGTAACGCAGGACT AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 171
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 166}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907695250_907695253 9 Left 907695250 1:56719563-56719585 CCACCATCTCAAAATTTTGACAT 0: 1
1: 0
2: 2
3: 27
4: 384
Right 907695253 1:56719595-56719617 AACTGATGTAACGCAGGACTAGG 0: 1
1: 0
2: 0
3: 4
4: 166
907695251_907695253 6 Left 907695251 1:56719566-56719588 CCATCTCAAAATTTTGACATGTA 0: 1
1: 1
2: 2
3: 30
4: 350
Right 907695253 1:56719595-56719617 AACTGATGTAACGCAGGACTAGG 0: 1
1: 0
2: 0
3: 4
4: 166
907695249_907695253 18 Left 907695249 1:56719554-56719576 CCACAGATTCCACCATCTCAAAA 0: 1
1: 0
2: 2
3: 27
4: 302
Right 907695253 1:56719595-56719617 AACTGATGTAACGCAGGACTAGG 0: 1
1: 0
2: 0
3: 4
4: 166

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907695253 Original CRISPR AACTGATGTAACGCAGGACT AGG Exonic
901698564 1:11030123-11030145 AATTGATGGAAAGGAGGACTGGG - Intronic
907695253 1:56719595-56719617 AACTGATGTAACGCAGGACTAGG + Exonic
907746277 1:57216844-57216866 ACTTGACGTAAGGCAGGACTGGG + Intronic
908340971 1:63178846-63178868 AAGTGAAGTAACTCAGGAATAGG + Intergenic
912161647 1:106992867-106992889 AAGTGAAGTAACTCAGGAATGGG + Intergenic
912692167 1:111812721-111812743 TACTCATGTGAAGCAGGACTGGG - Intronic
912742516 1:112213590-112213612 AGCTGTTGTAAGGCAGGCCTGGG - Intergenic
912962111 1:114205481-114205503 AAGTGAAGTAACTCAGGAATGGG + Intergenic
914346555 1:146804928-146804950 AAGTGAAGTAACTCAGGAATGGG + Intergenic
916201511 1:162275907-162275929 AAATGAGGTAAGGCAGGAGTTGG + Intronic
916426828 1:164688847-164688869 AACTGCTGTAATGCAAGTCTGGG + Intronic
917032897 1:170714502-170714524 AACTGATGTGACCCAGGCATAGG + Intronic
917609693 1:176674520-176674542 AAGTGAAGTAACTCAGGAATGGG - Intronic
918002447 1:180510192-180510214 AAATGAAGTAACTCAGGAGTGGG - Intergenic
1063170752 10:3508009-3508031 AAGTGATGTAACTCAGGAATGGG + Intergenic
1063257946 10:4350081-4350103 AAGTGAAGTAACTCAGGAATAGG - Intergenic
1067659143 10:48221318-48221340 AAGTGAAGTAACTCAGGAATGGG + Intronic
1068520648 10:58073571-58073593 AAGTGAAGTAACTCAGGAATGGG - Intergenic
1069060309 10:63887957-63887979 AACTGATGTAACTGAAAACTAGG - Intergenic
1076954667 10:133690300-133690322 AGGTGATGTAACGCTTGACTAGG - Intergenic
1079888072 11:26014659-26014681 AAATGTTGTAAAGCAGGAATTGG - Intergenic
1080670054 11:34367610-34367632 AAGTGAAGTAACTCAGGAATGGG - Intergenic
1082088631 11:48070412-48070434 AACTGCTGGAACGCAGGAGGCGG + Intronic
1087165808 11:95001050-95001072 AAGTGAAGTAACTCAGGAATGGG - Intergenic
1090758019 11:129812082-129812104 AAGTGAAGTAACTCAGGAATGGG + Intergenic
1091135402 11:133184278-133184300 AACTGCTGTAACTGAGGACAAGG + Intronic
1092108587 12:5943390-5943412 AAGTGAAGTAACTCAGGAATGGG + Intronic
1093600457 12:21015180-21015202 AAATGAAGTAACTCAGGAATGGG + Intergenic
1094764024 12:33571052-33571074 AAGTGAAGTAACCCAGGAATGGG + Intergenic
1095121290 12:38423186-38423208 AAGTGAAGTAACTCAGGAATGGG + Intergenic
1097803701 12:63942736-63942758 AACGGATGGAAGGCAGGAGTAGG - Intronic
1098703908 12:73663983-73664005 AAGTGATGTAACTGGGGACTTGG + Intergenic
1106433225 13:29702131-29702153 AAGTGAAGTAACTCAGGAATGGG + Intergenic
1106742729 13:32663979-32664001 AAGTGAAGTAACTCAGGAATGGG - Intronic
1108189616 13:47924219-47924241 AAGTGAAGTAACTCAGGAATGGG + Intergenic
1112836762 13:103524306-103524328 AGCTTATTTAACACAGGACTAGG + Intergenic
1113426527 13:110212999-110213021 AAGTGAAGTAACCCAGGAATGGG + Intronic
1116117558 14:40676047-40676069 AAGTGAAGTAACTCAGGAATGGG - Intergenic
1117756776 14:58982613-58982635 AAGTGAAGTAACTCAGGAATGGG - Intergenic
1121218819 14:92269731-92269753 AAGTGAAGTAACTCAGGAATGGG - Intergenic
1121495091 14:94386578-94386600 AACTGACGTAATGCATGAGTGGG + Intronic
1202854221 14_GL000225v1_random:40322-40344 AGCTGATGTAACGCTTGTCTAGG - Intergenic
1202854386 14_GL000225v1_random:41687-41709 ACGTGATGTAACGCTTGACTAGG - Intergenic
1202855835 14_GL000225v1_random:51712-51734 AGGTGATGTAACGCTTGACTAGG - Intergenic
1202856793 14_GL000225v1_random:56987-57009 AGGTGATGTAACGCTTGACTAGG - Intergenic
1202858588 14_GL000225v1_random:66034-66056 AGGTGATGTAACGCTTGACTAGG + Intergenic
1202859879 14_GL000225v1_random:74310-74332 AGGTGATGTAACGCTTGACTAGG + Intergenic
1202867204 14_GL000225v1_random:129151-129173 AGGTGATGTAACGCTTGACTAGG + Intergenic
1124069132 15:26375217-26375239 AAATGAGGTAACGCATGTCTGGG - Intergenic
1126179068 15:45767324-45767346 AATTGATGTAAACCAGGAGTTGG - Intergenic
1128596935 15:68960872-68960894 AAATGAAGTAACTCAGGAATGGG - Intronic
1129222170 15:74137328-74137350 AAATGATGTAAAGCAGGAAAGGG + Intronic
1129399694 15:75274805-75274827 AACTGATGTGACCCAGGACAAGG + Intronic
1129473212 15:75766506-75766528 AATTGATGTGACCCAGGACAAGG - Intergenic
1129731457 15:77934912-77934934 AATTGATGTGACCCAGGACAAGG - Intergenic
1132333919 15:101031014-101031036 AAGTGAAGTAACTCAGGAATGGG - Intronic
1133378633 16:5311100-5311122 AAGTGAAGTAACTCAGGAATGGG - Intergenic
1135214052 16:20549013-20549035 AAATGAGGTAACACAGGACATGG - Intronic
1135917403 16:26617311-26617333 AAGTGAAGTAACACAGGAATGGG - Intergenic
1139987425 16:70910340-70910362 AAGTGAAGTAACTCAGGAATGGG - Intronic
1140131242 16:72163803-72163825 AAGTGAAGTAACTCAGGAATGGG + Intronic
1141030378 16:80582527-80582549 AAGTGAAGTAACTCAGGAATGGG + Intergenic
1144771856 17:17763891-17763913 CACTGATGTCACTCAGGACCTGG + Intronic
1148799410 17:50213909-50213931 TACTGAGGTAACGCCTGACTGGG + Intergenic
1149471036 17:56915209-56915231 AATTTATGCAAAGCAGGACTGGG + Intergenic
1149791551 17:59482183-59482205 AATTCATGAATCGCAGGACTGGG + Intergenic
1152965056 18:106932-106954 AGGTGATGTAACGCTTGACTAGG + Intergenic
1152965120 18:107476-107498 AGGTGATGTAACGCTTGACTAGG + Intergenic
1157053205 18:44194801-44194823 AATTGATGTAAGACAGGAATTGG - Intergenic
1158374751 18:56850294-56850316 AAATGCTGTAAAGCAGGACCAGG + Intronic
1165330033 19:35136391-35136413 AACTGAGGCCACACAGGACTGGG - Intronic
1166160084 19:40946181-40946203 CACTGATGAAACTCAAGACTAGG - Intergenic
1166169027 19:41014135-41014157 CACTGATGAAACTCAAGACTGGG - Intronic
933302718 2:80560679-80560701 AACAGATGTAAAGCAGGAGGAGG - Intronic
933374068 2:81456436-81456458 AACTGATATAATGCTAGACTGGG + Intergenic
937158637 2:119739906-119739928 ACCTGCTGTAACACAGGTCTAGG + Intergenic
939639114 2:144618000-144618022 AAGTGAAGTAACTCAGGAATGGG - Intergenic
940784124 2:157963987-157964009 AAGTGAGGTAACTCAGGAGTGGG - Intronic
941329583 2:164163913-164163935 AACTTCTGTAACACAGGGCTAGG - Intergenic
942932896 2:181517394-181517416 AAATGATGTACCGCAGCACCAGG - Intronic
944031999 2:195245731-195245753 AAATGAAGTAACTCAGGAATGGG + Intergenic
945632551 2:212299905-212299927 AACTGATTTAATGTAGGACAGGG - Intronic
948051862 2:234984681-234984703 GAGTGATGTAACTGAGGACTCGG - Intronic
1169569074 20:6887185-6887207 AATTGATGTTTCACAGGACTGGG + Intergenic
1174691497 20:52510953-52510975 AAGTGAAGTAACTCAGGAATGGG + Intergenic
1174969887 20:55263134-55263156 AATTGATGAAACTAAGGACTAGG - Intergenic
1181978522 22:26749850-26749872 AAGTGAAGTAACTCAGGAATGGG - Intergenic
951730956 3:25809606-25809628 AGATGATGTAACTCAGGTCTAGG + Intergenic
957549987 3:81691690-81691712 AACTGCTGGAACCCAGGAGTTGG + Intronic
958646616 3:96882620-96882642 AAGTGAAGTAATGCAGGAATGGG - Intronic
960852795 3:122073717-122073739 AAGTGATGCAGCTCAGGACTGGG - Intronic
962072386 3:132045100-132045122 AACAGATGTAAAGCAAGAATAGG - Intronic
962192389 3:133325214-133325236 AAGTGAAGTAACTCAGGAATGGG + Intronic
963505509 3:146179914-146179936 AAGTGATGTAACTCAGGAATAGG - Intergenic
963792591 3:149599448-149599470 AACAGATGAAAAGCAGGATTTGG + Intronic
964418573 3:156476405-156476427 AAGTGAAGTAACCCAGGAATGGG - Intronic
967291365 3:187924039-187924061 AAATGAAGTAACTCAGGAATGGG + Intergenic
967357890 3:188593702-188593724 AAGTGAAGTAACTCAGGAATGGG - Intronic
970216977 4:13769426-13769448 AAGTGAAGTAACTCAGGAATGGG - Intergenic
971228793 4:24780530-24780552 AAGTGATGTAACTCATAACTGGG - Intergenic
972447514 4:39159524-39159546 ACCTGATGTGAAGCAAGACTGGG + Intergenic
973244057 4:47990904-47990926 AAGTGAAGTAACTCAGGAATGGG - Intronic
973549852 4:52022807-52022829 AACTGAGGTAACTCAGAAGTAGG + Exonic
975041652 4:69751846-69751868 AACAGATGGAAGGCAGGATTGGG - Intronic
975383568 4:73729695-73729717 AACTGCTGAAAGGCAGGGCTGGG - Intergenic
976617863 4:87096451-87096473 AACTGCTTTAGCCCAGGACTTGG - Intronic
977202684 4:94135412-94135434 AACTGATTTAACCCAGGAGGTGG + Intergenic
977512470 4:97978825-97978847 AAAAGATGTAAAGCAGGATTTGG + Intronic
978629032 4:110721405-110721427 AAGTGAAGTAACTCAGGAATGGG - Intergenic
985464458 4:190181577-190181599 AGGTGATGTAACGCTTGACTAGG - Intronic
988173954 5:27696308-27696330 AAGTGAAGTAACTCAGGAATGGG + Intergenic
988231214 5:28481999-28482021 AACTGCTTTAACCCAGGACGTGG + Intergenic
990760559 5:59125131-59125153 AACTGCTGTAATGCAACACTAGG - Intronic
991497336 5:67239573-67239595 GATTGTTGTAAAGCAGGACTAGG + Intergenic
993249167 5:85494277-85494299 AACTGCTGTAAGGCAGACCTAGG - Intergenic
994970691 5:106732585-106732607 AACTATTGTAAGGCAGGTCTGGG - Intergenic
995977750 5:118061716-118061738 AAGTGATGTCACGCAGTATTTGG + Intergenic
996279896 5:121716580-121716602 AAGTGAAGTAACTCAGGAATGGG + Intergenic
996295375 5:121908732-121908754 AAGTGAAGTAACTCAGGAATGGG + Intergenic
997876062 5:137548123-137548145 AAGTGAAGTAACTCAGGAATGGG - Intronic
998514300 5:142738619-142738641 AAGTGAAGTAACTCAGGAATGGG - Intergenic
998574018 5:143293260-143293282 AAGTGAAGTAACCCAGGAATGGG + Intronic
999982701 5:156973077-156973099 AAGTGAAGTAACTCAGGAATGGG - Intergenic
1000396732 5:160783277-160783299 AAGTGAAGTAACTCAGGAATTGG - Intronic
1003711509 6:8597107-8597129 AAGTGAAGTAACTCAGGAATGGG - Intergenic
1005191063 6:23225355-23225377 AAGTGAAGTAACTCAGGAATGGG - Intergenic
1005408770 6:25520486-25520508 AACTGGGGTAATGCATGACTGGG + Intronic
1009428660 6:63542154-63542176 AAGTGAAGTAACTCAGGAATGGG + Intronic
1010413034 6:75582277-75582299 AAGTGAAGTAACTCAGGAATGGG - Intergenic
1013424162 6:109995651-109995673 AAGTGAAGTAACTCAGGAATGGG + Intergenic
1014514571 6:122364120-122364142 AACTGATGCAACAGAGCACTGGG + Intergenic
1016474412 6:144410683-144410705 AAGTGAAGTAACTCAGGAATGGG - Intronic
1017224884 6:152009206-152009228 CACTCATGTAAAGAAGGACTTGG - Intronic
1021066064 7:16174213-16174235 TCCTGATGTAACTCAGAACTGGG + Intronic
1028007217 7:85589763-85589785 AACTGACTTAATGCAAGACTCGG + Intergenic
1029011711 7:97269034-97269056 AAGTGAAGTAACTCAGGAATGGG + Intergenic
1029954922 7:104628180-104628202 CACTGATGTAGAGCAGGAATGGG - Intronic
1031043334 7:116861806-116861828 AAGTGAAGTAACTCAGGAATGGG - Intronic
1039030540 8:33304456-33304478 AAGTGAAGTAACTCAGGAATGGG + Intergenic
1039431122 8:37525943-37525965 AAGTGAAGTAACTCAGGAATGGG + Intergenic
1041212518 8:55567087-55567109 AAGTGAAGTAACTCAGGAATGGG + Intergenic
1042498214 8:69479723-69479745 ATCTGAGGAAACACAGGACTGGG + Intronic
1044064696 8:87685069-87685091 AAGTGAAGTAACTCAGGAATGGG - Intergenic
1045384530 8:101658586-101658608 AACTGATGTAAGTCAGAACTGGG - Intronic
1048600641 8:135915813-135915835 AAGTGAAGTAACTCAGGAATGGG - Intergenic
1049787806 8:144459440-144459462 ACCTGACGTGAGGCAGGACTCGG + Intronic
1050747156 9:8889721-8889743 AAGTGAAGTAACTCAGGAATGGG - Intronic
1051598508 9:18849185-18849207 AAGTGATTTAAAACAGGACTAGG + Intronic
1052895741 9:33746906-33746928 AAGTGAAGTAACTCAGGAATGGG + Intergenic
1187197371 X:17100462-17100484 AAATGGTGTACCGCAGGCCTCGG + Intronic
1188263617 X:28043514-28043536 AACTGGTGTAGCGAAGGCCTTGG - Intergenic
1188909786 X:35832565-35832587 AAGTGAAGTAACTCAGGAGTAGG + Intergenic
1193361517 X:80585051-80585073 AACTCTTGTAAGGCAGGCCTGGG + Intergenic
1194435512 X:93864614-93864636 AAGTGAGGTAACACAGGAATGGG + Intergenic
1194827394 X:98579493-98579515 AAGTGAAATAACACAGGACTGGG - Intergenic
1196172011 X:112599196-112599218 AAGTGAAGTAACTCAGGAATGGG + Intergenic
1196777439 X:119352432-119352454 AAGTGAAGTAACTCAGGAATGGG + Intergenic
1199122049 X:144066639-144066661 AAGTGAGGTAACTCAGGAATGGG + Intergenic
1200377273 X:155796364-155796386 AAGTGAGGTAACTCAGGAATGGG - Intergenic
1200562187 Y:4718637-4718659 AAGTGAAGTAACTCAGGAATGGG - Intergenic
1201124995 Y:10904855-10904877 AGGTGATGTAACGCTTGACTAGG + Intergenic
1201126590 Y:10920640-10920662 AGGTGATGTAACGCTTGACTAGG + Intergenic
1201175261 Y:11304920-11304942 AGGTGATGTAACGCTTGACTAGG - Intergenic
1201177758 Y:11320454-11320476 AGGTGATGTAACGCTTGACTAGG - Intergenic
1201179261 Y:11330845-11330867 AGGTGATGTAACGCTTGACTAGG - Intergenic
1201352974 Y:13066715-13066737 AAGTGAAGTAACTCAGGAATAGG + Intergenic
1201414325 Y:13732604-13732626 AAGTGAAGTAACTCAGGAATGGG - Intergenic
1202255336 Y:22914717-22914739 AAGTGATGTAACACATCACTTGG + Intergenic
1202408327 Y:24548466-24548488 AAGTGATGTAACACATCACTTGG + Intergenic
1202462455 Y:25121614-25121636 AAGTGATGTAACACATCACTTGG - Intergenic
1202624430 Y:56842923-56842945 AACTGATGTAACACTTGAGTAGG + Intergenic