ID: 907695312

View in Genome Browser
Species Human (GRCh38)
Location 1:56720760-56720782
Sequence CTGGGGATAGGGTGCGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 814
Summary {0: 1, 1: 0, 2: 5, 3: 56, 4: 752}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907695312 Original CRISPR CTGGGGATAGGGTGCGGGGA GGG (reversed) Intronic
900101654 1:964603-964625 GTGGGGATGTGCTGCGGGGAGGG + Intronic
900159099 1:1215114-1215136 CTGGGGAGCAGGTGCGGGGCTGG + Intergenic
900237673 1:1600294-1600316 GTGGGGCTGGGGTGCGGGCAGGG + Intergenic
900292486 1:1929367-1929389 AGGGGGAGAGGGTGGGGGGAGGG + Intronic
900389860 1:2429123-2429145 CTGGGGATTGGGTGCGAGGAGGG + Intronic
900478539 1:2887402-2887424 CTGAGGATGGGGGTCGGGGAAGG + Intergenic
900550045 1:3250120-3250142 CTGGGAGTGGGGTGGGGGGAGGG - Intronic
900651502 1:3732307-3732329 CTGGGGACAGGTTGCGGGGAGGG - Intronic
900662302 1:3790798-3790820 CTGGGGAATGGCTGTGGGGATGG + Intronic
900987150 1:6079707-6079729 CTGGAGGCAGGGAGCGGGGAAGG + Intronic
901229385 1:7633489-7633511 CAGAGACTAGGGTGCGGGGAAGG - Intronic
902025614 1:13381306-13381328 CCCAGGATAGGGTGTGGGGAAGG + Intergenic
902364576 1:15963500-15963522 CTGGGGATGGGGTGGAGGGTGGG - Intronic
902691650 1:18113591-18113613 GTGGGGGTGGGGTGCGGGGTTGG - Intronic
902776172 1:18676388-18676410 CTGGGGAGAGAGGGTGGGGAGGG + Intronic
903255158 1:22092593-22092615 CTGGGGGTAGGGTGGGGGTGGGG + Exonic
903298392 1:22360632-22360654 CTGGGCAGAGGGTGTGGGGTTGG + Intergenic
903907799 1:26697815-26697837 CGGGGCAGAGTGTGCGGGGAAGG + Intronic
904334987 1:29791141-29791163 CTAGGCATAGGGAGCAGGGAGGG + Intergenic
904433475 1:30479603-30479625 CTGGGGAAGGGGTGGAGGGAAGG - Intergenic
904620252 1:31770856-31770878 CTGTGGATGGGGTGGGGGTAGGG + Intergenic
904919225 1:33993856-33993878 ATGGAGATAAGGTGCGGGCAGGG - Intronic
904982387 1:34517502-34517524 CAGGGGTGAGGGTGAGGGGAGGG + Intergenic
905189851 1:36224871-36224893 ATGGGGACTGGGTGGGGGGAAGG - Intronic
905581150 1:39083181-39083203 ATGAGGATGGGGTGGGGGGATGG - Intronic
905606387 1:39304167-39304189 GGGGGGATGGGGTGGGGGGAGGG - Intronic
905827117 1:41034233-41034255 CTCGGGTTGGGGTGGGGGGAGGG + Intronic
906197856 1:43940150-43940172 CTGGGGATAGGGAAAGGGGATGG - Intergenic
906484209 1:46221976-46221998 CTGGGGACAGGGTGGGGGAAGGG - Intergenic
906640177 1:47436998-47437020 CTGGGGCCAGGGAGAGGGGAGGG + Exonic
906651810 1:47518123-47518145 CTGGGTAGAGAGTGAGGGGAGGG - Intergenic
906666949 1:47628635-47628657 CTGGGGATGGAGTGGGGGGTGGG + Intergenic
906745818 1:48221499-48221521 CTGGGGATAGGGTGTGGGACAGG + Intergenic
906745829 1:48221533-48221555 CTGGGGATGGGGTGTGGGACAGG + Intergenic
906775983 1:48530015-48530037 TGGGGGATAGGGAGAGGGGAAGG - Intergenic
907286930 1:53386687-53386709 CTGGGGAGAGGCTGCAGGGCAGG + Intergenic
907695312 1:56720760-56720782 CTGGGGATAGGGTGCGGGGAGGG - Intronic
908574901 1:65449356-65449378 CTGGGGATGGGCTGAGGGCAAGG + Intronic
909445217 1:75742145-75742167 CTGGGGGTGGGGAGGGGGGAAGG - Intronic
910478536 1:87634228-87634250 CTGGGGAATGGGTGGGGGGAGGG + Intergenic
911666062 1:100554016-100554038 CTGGGGAAAGGGTGGGAGGGGGG - Intergenic
912955656 1:114153004-114153026 CGGGGGACAGGGGGCGGGGTGGG - Intronic
913089654 1:115467935-115467957 CTGGGGGTAGGATGAGGGGGTGG + Intergenic
915142814 1:153777578-153777600 CTGGGGACAGGGGCCGGGGGAGG + Intronic
915310488 1:155003836-155003858 CTTGGGATGGGGTGGGAGGAGGG - Intronic
916131804 1:161617377-161617399 GTGGGGAGAGGGGGAGGGGAGGG + Intronic
916143665 1:161721878-161721900 CTGGGGAGGGGTTGCAGGGAAGG + Intronic
916705493 1:167345050-167345072 CAGGGGTGAGGGTGAGGGGAGGG + Intronic
917470397 1:175321573-175321595 CTGGGCAGATGTTGCGGGGATGG + Exonic
917716048 1:177739144-177739166 CTGTGTAGAGGGAGCGGGGAAGG + Intergenic
918146738 1:181763209-181763231 CTGGGGATAGAGAGCAGGCATGG + Intronic
918356747 1:183711780-183711802 CTGGGAATGGGGTGTGGGGGCGG + Intronic
919641371 1:200048146-200048168 TTGGGGGTGGGGTGGGGGGAAGG - Intronic
919817056 1:201448291-201448313 CCGGATGTAGGGTGCGGGGAGGG - Intergenic
920123673 1:203676808-203676830 GTGGGGGTGGGGTGAGGGGAGGG + Intronic
920205886 1:204291766-204291788 CTGGGGCCAGGGTGGAGGGAGGG + Intronic
920575166 1:207053740-207053762 CTAGGGAGAGGGTGCGGAGCAGG + Intronic
920859869 1:209697003-209697025 CAGGGGATAGAGTTCTGGGATGG + Intronic
920912563 1:210232585-210232607 CTGGGGTGGGGGTGCGGGAAAGG + Intergenic
920912816 1:210233562-210233584 CTGGGAGGAGGGTGCGGGGGCGG - Intronic
922558118 1:226548640-226548662 TTGGGGGGAGGGGGCGGGGAAGG + Intergenic
922749137 1:228062617-228062639 TTGGGGTGAGGGTGTGGGGAGGG - Intergenic
922883902 1:229003484-229003506 CTCGGGACAGGGGGAGGGGAGGG + Intergenic
1062788947 10:289203-289225 CTGGGGACAGGGTGCGGGCAGGG + Intronic
1063086068 10:2818545-2818567 GAGGGGATGGGGTGTGGGGACGG + Intergenic
1063439403 10:6060256-6060278 CAGGGGAAAGGGTGCGAGGTGGG + Intronic
1063736349 10:8759459-8759481 CTAGGGGTGGGTTGCGGGGAGGG + Intergenic
1063751656 10:8955485-8955507 TTGGGGGTTGGGTGCGGGGAGGG + Intergenic
1063877272 10:10493271-10493293 CTGGGGAGAGGGGGCATGGATGG + Intergenic
1063888569 10:10605269-10605291 CGGGGGGTGGGGTTCGGGGAGGG + Intergenic
1064194582 10:13234566-13234588 CTGGGGATCTGCTGCTGGGAAGG + Intergenic
1065815641 10:29480248-29480270 CTGGGGACAGGGGCAGGGGAGGG + Intronic
1065957290 10:30704956-30704978 CTGGGGACAGGGGCAGGGGAGGG - Intergenic
1066181082 10:32961394-32961416 CTGGGGGTCGGGGGCGGGGGTGG - Intronic
1067806331 10:49395725-49395747 CTGGGGCCAGGGTGAGGGCACGG - Intronic
1068748165 10:60559259-60559281 CTGGGGAAAGGGTTGGGGGGTGG - Intronic
1069622999 10:69849329-69849351 CAGGGGATGGGGAGCGGGGGTGG + Intronic
1069739468 10:70678471-70678493 CTGGGGTCAGGGGGTGGGGAGGG + Intronic
1070126430 10:73625855-73625877 CTGGGGAGGGGGTGCGGGGAAGG - Intronic
1070404829 10:76085526-76085548 CTGGGGCTGGGGTGGAGGGAGGG + Intronic
1070992889 10:80747852-80747874 ATGGGGAAAGGGTACGGGGCCGG + Intergenic
1071563522 10:86660157-86660179 CTGGTCCTAGGGTGCGAGGATGG - Intronic
1073104728 10:101026083-101026105 CTGGGGAAAGTAGGCGGGGAAGG + Intronic
1073139809 10:101239633-101239655 CTGGAGAATGGGGGCGGGGAGGG - Intergenic
1073357654 10:102869903-102869925 CGGGGGACAGGGTGCGGGCCAGG - Intronic
1074853230 10:117455316-117455338 CCGGGGGGAGGGTGCGGGGGTGG + Intergenic
1074899532 10:117804339-117804361 CTGGGGATCGGGGGAGGGGTGGG - Intergenic
1076391838 10:130109348-130109370 CAGGGGATGGTGTGAGGGGAAGG + Intergenic
1076746659 10:132517969-132517991 CTGGGGACAGGGTGCAAGGCTGG - Intergenic
1077429207 11:2507683-2507705 CTGGGGAGAGAGTGCGGGCTGGG + Intronic
1077455163 11:2673977-2673999 TTGGGGGTGGGGTGGGGGGAGGG + Intronic
1078314407 11:10280828-10280850 CTGGGGATTGGGGGTGGGGGAGG + Intronic
1078574336 11:12485791-12485813 GTGGGGACAGGGTAGGGGGAGGG + Intronic
1079205694 11:18412571-18412593 CTGGTCAAAGGATGCGGGGAGGG - Intronic
1079244749 11:18743955-18743977 CTGGAGAGAGGGTGGGTGGAGGG - Intronic
1079277301 11:19053205-19053227 CGGGGGGTGGGGTGAGGGGAGGG - Intergenic
1079752209 11:24213223-24213245 CTGGTGATAGGCTCCAGGGAAGG + Intergenic
1081537405 11:44005711-44005733 CTGGGGGTAGAGGGCGGGGGAGG - Intergenic
1081601733 11:44500197-44500219 CCAGGCATGGGGTGCGGGGAGGG + Intergenic
1081979566 11:47257949-47257971 TTGGGGAAAGGCTGAGGGGAGGG - Intronic
1081997360 11:47374206-47374228 CTGGGGATGGAGTTGGGGGAGGG + Intronic
1082688083 11:56264386-56264408 CTGGGGATAGTGGGTGGGGTTGG - Intergenic
1083333327 11:61909189-61909211 CTGGGGATGGGGGGCTGGGCGGG + Intronic
1083638375 11:64132428-64132450 CTGGGGGTGGGGCGGGGGGAGGG + Intronic
1084403084 11:68956138-68956160 CTGGGGGTGGGGTGGGGGCAGGG + Intergenic
1084403101 11:68956168-68956190 CTGGGGGTGGGGTGGGGGCAGGG + Intergenic
1084421849 11:69064279-69064301 CGGGGGATAGGGAGGGGGGAGGG - Intronic
1084940692 11:72611360-72611382 CTGGGGATCGGGTGCTGAGCAGG - Intronic
1084956576 11:72694810-72694832 GTGGTGATAGGGTGCTGGCAGGG - Intronic
1085256231 11:75175120-75175142 CTGGGGATGGGGAGTGGGGAGGG + Intronic
1085514890 11:77106250-77106272 GTGGGGGTTGGGTGCGGGGCTGG - Intronic
1085561295 11:77474267-77474289 CAGGTGAGAGGGGGCGGGGAGGG + Intronic
1085654718 11:78303039-78303061 CTCGGGAAAGGGTGAGAGGAGGG + Intronic
1085986061 11:81789932-81789954 CGGGGGAAAGGGTGGGAGGAGGG + Intergenic
1086186738 11:84026688-84026710 CTGGGAATATGGAGTGGGGAAGG - Intronic
1086416003 11:86589333-86589355 ATGGGGGTAGGGTTGGGGGAGGG + Intronic
1086497906 11:87422768-87422790 CCTGGGATAGCCTGCGGGGAAGG - Intergenic
1087603042 11:100339915-100339937 CTGGGGGTAGGGAGGGTGGAGGG - Intronic
1087990665 11:104743111-104743133 GTGGGGATGGGGGGTGGGGAAGG + Intergenic
1089224690 11:116907906-116907928 TTGGGGATAGAGTGTGAGGATGG - Intronic
1089520573 11:119059931-119059953 CTGGGGAAAGGGGGAGGGGGAGG + Intergenic
1089694092 11:120205829-120205851 CTGGGGGTGGGGAGCAGGGAAGG + Intergenic
1089860551 11:121586681-121586703 CTGGGGGTAGAGTGGGGGGGGGG + Intronic
1090202226 11:124865195-124865217 CTGGGCTTGGGGTGCGGGGCGGG + Intergenic
1090417336 11:126549588-126549610 CTGGGGAGAGGGCTGGGGGAGGG + Intronic
1090785217 11:130042581-130042603 CTGGGGATAGGGGTTGGGGTCGG + Intergenic
1091455635 12:605350-605372 CTGGGGATAGGTGTTGGGGAAGG - Intronic
1091556997 12:1581342-1581364 CTGGGGAGAGGGTTTGGGGAAGG + Intronic
1091636528 12:2201249-2201271 CTGCGGCTAAGTTGCGGGGAAGG - Intronic
1091753814 12:3038987-3039009 CTGGGGAAGGGGTGAGGAGAGGG - Intronic
1092204946 12:6608938-6608960 CTGGGGATGTGGTGAGGGGGAGG - Intergenic
1092282600 12:7109013-7109035 GGGGGGGTAGGGTGGGGGGAGGG + Intronic
1092539804 12:9413651-9413673 CGGGGGGTGGGGGGCGGGGATGG + Intergenic
1092880691 12:12885668-12885690 CTGGGGACTGGGTGTGGGGCGGG + Intergenic
1093121113 12:15272864-15272886 CTGGGGACATGGAGTGGGGAAGG - Intronic
1093711367 12:22333797-22333819 CTGGGGATCAGGGGTGGGGAAGG + Intronic
1094524917 12:31225180-31225202 CTGGAGATGGGGTGGCGGGAGGG + Intergenic
1095089186 12:38088091-38088113 GTGGGGATAGGGTGGGTGAAGGG + Intergenic
1095703276 12:45212825-45212847 CGGGGGGTGGGGTGGGGGGAGGG - Intergenic
1095862070 12:46928537-46928559 CTGGGGTTGGGGTCTGGGGATGG + Intergenic
1096334111 12:50740073-50740095 CTGGGCAGAGGGTGATGGGAGGG - Intronic
1096671290 12:53199678-53199700 GTGGGGATGGGGTTGGGGGATGG - Intronic
1096909211 12:54965338-54965360 CAGGGGATGGGGTGAGAGGAGGG - Intronic
1096976206 12:55700501-55700523 TTGGGGACAGGGTGGGGAGAGGG - Intronic
1096984332 12:55745983-55746005 GGGGGGTTAGGGTGGGGGGAAGG + Intronic
1097710135 12:62909009-62909031 CAGGGGATAGGGTGGGGTGGGGG - Intronic
1097787859 12:63780332-63780354 CCTGGGATCGGGAGCGGGGACGG - Intronic
1098733885 12:74071997-74072019 CCGGGGGTGGGGTGGGGGGAGGG + Intergenic
1098830530 12:75355975-75355997 TTGGGGGTAGGGTGGGGAGAGGG + Intronic
1099109999 12:78546850-78546872 TGGGGGTTAGGGTGGGGGGAGGG + Intergenic
1100177796 12:92050649-92050671 CTGGGGAAGGGTTGGGGGGATGG + Intronic
1101017803 12:100519766-100519788 CTGGGGATAGGGAGTTGGGAGGG + Intronic
1101191049 12:102332930-102332952 CTGGGGACAGGGTGCCTGGAAGG + Intergenic
1101564784 12:105895170-105895192 CTGTGGGTAGGGTTCGGGGGTGG - Intergenic
1101876205 12:108598184-108598206 GTGGGGACAGGGGGAGGGGAGGG + Intronic
1102074363 12:110048254-110048276 CAGGGGATAGAGTGGGGAGATGG - Intronic
1102475559 12:113185959-113185981 GTGGGAAGAAGGTGCGGGGACGG + Exonic
1102543322 12:113637954-113637976 CTGGGGAAGGGGTGGGGGTAGGG - Intergenic
1102547191 12:113665701-113665723 CTGGGGATGGAGTGAAGGGAGGG - Intergenic
1102681520 12:114693504-114693526 GTGGGGAAAGGGTGGGGGGTGGG - Intergenic
1103057667 12:117834431-117834453 CTGGGGGTGGGGGGCGGGGTAGG + Intronic
1103247877 12:119473600-119473622 CTGGGGGAAGGGTGGGAGGAGGG - Intronic
1104512433 12:129392708-129392730 CTGGGGTGAGGGTTGGGGGAGGG - Intronic
1104571919 12:129933501-129933523 CTGGGGGTAGGGTCTGGGGTGGG - Intergenic
1104670499 12:130676850-130676872 CTGGGGTCAGGGTGAGGGGAGGG + Intronic
1104699230 12:130889062-130889084 CTGGGGATGGGGTGGAGGTAGGG - Intergenic
1104743010 12:131192845-131192867 CCAGGGATAGGGAGGGGGGAAGG - Intergenic
1104757662 12:131279158-131279180 GTGGGGAGAGGGAGAGGGGAAGG + Intergenic
1104843243 12:131834512-131834534 CTGGGGGCAGGGGGCAGGGAGGG + Intronic
1105214764 13:18277719-18277741 CTGGGGGTGGGGCGGGGGGAGGG + Intergenic
1105535182 13:21259334-21259356 CCGGGGACGGGGTGCGGGGGGGG + Intergenic
1105761880 13:23522617-23522639 CTATGGAAAGGGTGGGGGGATGG + Intergenic
1106110228 13:26770775-26770797 CTGGGGTTAGGGTGGAGGGAGGG + Intergenic
1108323355 13:49307115-49307137 CTGGGGATGGGGGGCGGGTATGG - Intergenic
1108432815 13:50371353-50371375 CTGGGGATTGGGTGCAAGAATGG + Intronic
1108545811 13:51492222-51492244 TTGGGGGTGGGGTGGGGGGAGGG - Intergenic
1108588700 13:51893411-51893433 CTGAGATTAGGGTGCAGGGAAGG - Intergenic
1109018733 13:57056280-57056302 CTGGGGATAGGCTGGGAGAAAGG + Intergenic
1110128830 13:71981090-71981112 CAGGGGCTAGGGTGTGGGAAGGG - Intergenic
1110983900 13:81939194-81939216 TGGGGGGTAGGGTGAGGGGAGGG + Intergenic
1111132442 13:83995018-83995040 CAGGGGTTAGGGTGCAGGGAGGG + Intergenic
1111143011 13:84146525-84146547 CTGGGCATGGGGTGAGGTGAGGG + Intergenic
1111196703 13:84883888-84883910 CTGGGAATAGGGAGCAGGGCAGG + Intergenic
1113042135 13:106115956-106115978 TCGGGGGTAGGGTGTGGGGAGGG - Intergenic
1113085630 13:106567437-106567459 CTGGGGACCGGGCGCGGGAACGG - Intronic
1113264186 13:108598995-108599017 CTGGGGATGGGGTGGGGGGAGGG - Intronic
1113703739 13:112410209-112410231 CCTGTGATGGGGTGCGGGGATGG + Intronic
1113804844 13:113106723-113106745 GTGGGGATGGCGTGTGGGGATGG + Intronic
1113810834 13:113141465-113141487 CTGGAGCTAAGGTGCGGGGCTGG + Intronic
1114482268 14:23043160-23043182 CTGGGGAGTGGGTGGGAGGATGG + Exonic
1115207485 14:30925220-30925242 CTGGGGGGAGGGGGCGGGCAGGG + Intronic
1115774748 14:36702920-36702942 GTGGGGATATGTAGCGGGGAGGG - Intronic
1115804279 14:37033754-37033776 CTGGGAAGAGGGTACGTGGATGG + Intronic
1117065273 14:52007615-52007637 CTGGGGTTTGGGTGGAGGGAAGG - Exonic
1117283279 14:54261418-54261440 ATGGGGAAAGGGTACGGGGCAGG - Intergenic
1117913705 14:60656640-60656662 CTGGGTAGAGGGTGCTGGGAAGG + Intronic
1117943960 14:60998279-60998301 ATGGGTACAGGATGCGGGGATGG - Intronic
1118009092 14:61591508-61591530 TGGGGGATGGGGTGGGGGGAGGG + Intronic
1118749472 14:68795629-68795651 CCGGGGAGAGGGGGAGGGGAGGG - Intronic
1118897070 14:69953928-69953950 CTGGGGATAGAAAGCAGGGAGGG - Intronic
1119199787 14:72743777-72743799 CTGGGGAGATGGTCCGGGGGAGG + Intronic
1119217821 14:72882761-72882783 CTGGTGATAGGGGGAGGGCAGGG - Intronic
1120630937 14:86889274-86889296 CTGGAGGTAGGGTTGGGGGATGG + Intergenic
1120803762 14:88722609-88722631 TTGGGGGTGGGGTGAGGGGAGGG + Intronic
1121092800 14:91194498-91194520 CTGAGGTTAGGGAGGGGGGATGG + Intronic
1121108165 14:91294129-91294151 CTGTGGTGAGGGTGCGGAGAGGG + Intronic
1121615127 14:95308649-95308671 ATGGGGAGTGTGTGCGGGGAGGG - Intronic
1122012811 14:98766745-98766767 CTATGGATTGGGTGCAGGGAGGG - Intergenic
1122078670 14:99252108-99252130 CTGGGGTTTGGGTGTTGGGATGG - Intronic
1122138915 14:99650490-99650512 GTAGGGGTAGGGTGCAGGGAGGG + Intronic
1122154596 14:99742554-99742576 CTGGGGCTGGGGTGCTGGGACGG + Intronic
1122316141 14:100827076-100827098 CTGGGGATGGGGTGCCGCGGGGG + Intergenic
1122825749 14:104369660-104369682 CTGGGGGTGGGGTGAGGGGAGGG - Intergenic
1122853416 14:104548630-104548652 CTGGGGCTGGGGTGGGGGCAGGG - Intronic
1122885683 14:104709393-104709415 CTGGGGGTGGGGTGTGGGGGTGG - Intronic
1122914766 14:104853710-104853732 CAGGGGACAGTGTGTGGGGAAGG - Intergenic
1124136136 15:27037944-27037966 CTGGGGACGGGGTGAGGGCAAGG - Intronic
1124348095 15:28935652-28935674 CTGGAGAGAGGCTGAGGGGAGGG - Intronic
1124641355 15:31398464-31398486 CTGGGTGTAGGCTGCGGGGTTGG - Intronic
1125270668 15:37935413-37935435 CTTGGGGTAGGGTGCGGAGGTGG - Intronic
1125884582 15:43219059-43219081 CTGGGGGGAGGGGGCGGTGAGGG + Intronic
1125956640 15:43795023-43795045 CTGGGGATATGATGCGGTGGCGG + Exonic
1128368531 15:67022338-67022360 ATGGGGTTAGGTTGCTGGGACGG + Intergenic
1128385668 15:67146556-67146578 TCGGGGATGGGGAGCGGGGAGGG + Intronic
1128658591 15:69481198-69481220 CTGTGGGTTGGGTGCGGGAATGG - Intergenic
1128766251 15:70252954-70252976 CTGGGGAGAGTGGGCAGGGAGGG - Intergenic
1129908887 15:79209698-79209720 CTGCAGAGAGGGGGCGGGGAGGG + Intergenic
1130223681 15:82043090-82043112 CTGGGGAAAGAGGGTGGGGAGGG + Exonic
1131090672 15:89622695-89622717 CTGGGGAGGTGGAGCGGGGAGGG - Intronic
1131285516 15:91053781-91053803 CTGGGGTTAGGGAGGGGTGAAGG - Intergenic
1131632724 15:94196147-94196169 CTGGGCACAGGGTGCAGGGCAGG + Intergenic
1131833393 15:96368367-96368389 CTGGGCAAAGGGGGTGGGGAAGG - Intergenic
1132317898 15:100903182-100903204 CTGGGGATACCGTGGGGAGAAGG - Intronic
1132515260 16:363105-363127 CTGGGGACAGGATGTGGGTAGGG + Intergenic
1132608625 16:803981-804003 CAAGGGATGGGGTGGGGGGAGGG + Intergenic
1132639521 16:971209-971231 CTGCGGGTAGGGCGCGGGGCCGG + Intronic
1132670939 16:1102111-1102133 CTGGGCATGGGGTGTGGGGGAGG - Intergenic
1134354115 16:13465108-13465130 CTGGGGGTAGGGGGCTGGGTAGG + Intergenic
1134414240 16:14029989-14030011 CTGGGCATGGGGAGGGGGGAGGG + Intergenic
1134690814 16:16190108-16190130 CTGGGGAAGGAGTGCGGGGGTGG - Intronic
1134867187 16:17618967-17618989 CCAGGGTTAGGGTTCGGGGAAGG + Intergenic
1135238586 16:20782390-20782412 CTGGGGAAAGGGTGGGAGGTGGG - Intronic
1135563541 16:23494606-23494628 CTGGGGGTTGGCTGAGGGGAGGG - Intronic
1135941358 16:26824776-26824798 CCGGGGGTAGGGTGCGGGTTGGG + Intergenic
1136073956 16:27805227-27805249 CTGGGATTGGGGTGGGGGGAGGG + Intronic
1136073985 16:27805292-27805314 CTGGGATTGGGGTGGGGGGAGGG + Intronic
1136073999 16:27805324-27805346 CTGGGATTGGGGTGGGGGGAGGG + Intronic
1136074013 16:27805356-27805378 CTGGGATTGGGGTGGGGGGAGGG + Intronic
1136074027 16:27805388-27805410 CTGGGATTGGGGTGGGGGGAGGG + Intronic
1136074071 16:27805486-27805508 CTGGGATTGGGGTGGGGGGAGGG + Intronic
1136074085 16:27805518-27805540 CTGGGATTGGGGTGGGGGGAGGG + Intronic
1136074099 16:27805550-27805572 CTGGGATTGGGGTGGGGGGAGGG + Intronic
1136074128 16:27805615-27805637 CTGGGATTGGGGTGGGGGGAGGG + Intronic
1136074142 16:27805647-27805669 CTGGGATTGGGGTGGGGGGAGGG + Intronic
1136074171 16:27805712-27805734 CTGGGATTGGGGTGGGGGGAGGG + Intronic
1136074185 16:27805744-27805766 CTGGGATTGGGGTGGGGGGAGGG + Intronic
1137531491 16:49281479-49281501 CTGGGGGTGGGGGGCGGGGTGGG - Exonic
1137534132 16:49304716-49304738 CTGGGGAAAGGGAGTGGAGAAGG + Intergenic
1137639699 16:50017817-50017839 CTGGGGAGGTGGTGGGGGGATGG - Intergenic
1137665616 16:50247237-50247259 CTGGGGACAGGCTGTGGGGAGGG + Intronic
1138232478 16:55348868-55348890 GTGGGGGTAGGGTGGGGGGTGGG + Intergenic
1138482691 16:57314274-57314296 CAGGGGATAGGGTGTGAGGCTGG + Intergenic
1138546405 16:57722282-57722304 CTGGGGCTAGGGCCTGGGGATGG + Intronic
1138691891 16:58776186-58776208 CAGGGGGTAGGGTAGGGGGAGGG + Intergenic
1138969223 16:62124333-62124355 CAGGGGTTGGGGTGTGGGGAGGG + Intergenic
1139851065 16:69951821-69951843 CTGGGGTTGGGGTGGCGGGAGGG - Intronic
1139880045 16:70174733-70174755 CTGGGGTTGGGGTGGCGGGAGGG - Intronic
1139955618 16:70691661-70691683 CTGGGGAAATGGGGCAGGGAAGG + Intronic
1140045762 16:71439554-71439576 CTAGGGATAGAATGGGGGGAAGG + Intergenic
1140256885 16:73345384-73345406 CGGGGGGTGGGGTGGGGGGAGGG - Intergenic
1140372466 16:74420784-74420806 CTGGGGTTGGGGTGGCGGGAGGG + Intronic
1140503866 16:75457519-75457541 CTGGGATTAGGGTGCCAGGATGG - Intronic
1140935549 16:79666364-79666386 CTGGGAACAGGGTGTGGGGAGGG - Intergenic
1141699975 16:85637911-85637933 CTGGGCAGAGGGGGCAGGGATGG + Intronic
1141898932 16:86977477-86977499 CTGGGGATCGGGGGCGGTGGGGG + Intergenic
1142004733 16:87684297-87684319 GTGGGGAGGGGGTGCGTGGATGG + Intronic
1142120078 16:88382897-88382919 CTGGGGGGAGGGTGCGGGGGCGG + Intergenic
1142367378 16:89657361-89657383 CTGGGGATGGGGTCCGGGTCGGG + Intronic
1142645020 17:1305991-1306013 CAGGGGAGAGGGTGCGGGCCAGG + Intergenic
1142801770 17:2350748-2350770 CTGGGCATGAGGTGCAGGGAGGG + Intronic
1142860204 17:2756270-2756292 CTGGGGACAGGGCGCAGAGAAGG + Intergenic
1142988930 17:3716080-3716102 CCGGGGTCAGGGTGGGGGGAAGG + Intronic
1143134547 17:4704174-4704196 CTGGGGAGGGGGCGTGGGGAGGG + Exonic
1143481368 17:7229342-7229364 CTGTGGCTAGGGCGTGGGGAGGG - Intronic
1143587165 17:7856032-7856054 CTGGGGCTGGGGGGCGGGGCTGG + Exonic
1144034706 17:11354742-11354764 CTGAGGATAGGGGGTGGGGGAGG - Intronic
1144196951 17:12903743-12903765 CAGGGGAAAGGGTGGGAGGAGGG - Intronic
1144395657 17:14840470-14840492 CTGAGGGTAGGGTGCTGGCATGG - Intergenic
1144662151 17:17078088-17078110 CTGGGGACAGGGAGTGGGCAAGG - Intronic
1144823213 17:18089834-18089856 CTGGGGCTGGGGTGCAGTGATGG + Intronic
1145895958 17:28458162-28458184 ATGGGGAGAGGGAGCGGGGGAGG - Intronic
1146056005 17:29581550-29581572 CTGGGGCTAGGGAGTGGGGGTGG - Intronic
1146058788 17:29593792-29593814 CTGGGGAGGGGGTGCGGCGCGGG + Intronic
1146110524 17:30084982-30085004 GCGGGGAGAGGGGGCGGGGACGG - Intronic
1146238798 17:31194380-31194402 GGAAGGATAGGGTGCGGGGAGGG + Intronic
1146374564 17:32285391-32285413 CTGGGGAGTGGGGGCCGGGAGGG + Intronic
1146445484 17:32929398-32929420 CTGGGGACCGGGGGAGGGGAAGG + Intronic
1146489003 17:33266536-33266558 CTGGGGGTGGGGGGTGGGGATGG - Intronic
1146846450 17:36184149-36184171 CTGGGACTGGGGTGTGGGGAGGG + Intronic
1146903518 17:36602850-36602872 CTGGGGAAGGGGTGCAGGAAAGG - Intronic
1146909593 17:36640070-36640092 CTAGGGCTAGGGGACGGGGAGGG - Intergenic
1147025430 17:37578638-37578660 CTTGAGACAGGGTGCTGGGAGGG - Intronic
1147605911 17:41773620-41773642 CTGGGGAAGGGGTGTGGGGAAGG - Intronic
1147610346 17:41798342-41798364 CTGGGGACAGGGAGAGGAGAGGG - Intergenic
1147685300 17:42283538-42283560 CTGGGAATAGCATGAGGGGAAGG - Intergenic
1147702416 17:42404350-42404372 GTGGGGAGAGGCTGAGGGGAAGG + Exonic
1147935599 17:44008856-44008878 CTGGGGATTAGGGGAGGGGAGGG + Exonic
1147951125 17:44108619-44108641 ATGGGGAGAGGGGGTGGGGAGGG + Intronic
1148150979 17:45396321-45396343 ATGGGGATAGGGTGGGGCTACGG + Intronic
1148437254 17:47694207-47694229 CTGGGGCTAGGGCTGGGGGAGGG + Intronic
1148680425 17:49470428-49470450 CTGGGGATCGGGGTGGGGGAGGG + Intronic
1148766291 17:50040499-50040521 CAGGGGAGAGGGCGAGGGGAGGG - Intergenic
1148794756 17:50191673-50191695 ATGGAGATAGGGTGTGGGGTGGG - Intronic
1148799326 17:50213326-50213348 CTGGGGATATGGTGTGTGCAGGG - Intergenic
1148872751 17:50668355-50668377 CTGGGGATGGGGCGAGGGTAGGG + Intronic
1148943598 17:51238078-51238100 CTGGGGATGGGGTGGGGGCCAGG + Intronic
1149287090 17:55176923-55176945 GTGGGGATAGGGTGAGGGTGGGG - Intergenic
1149849795 17:60027542-60027564 CTGGGGCTGGGGTGTGGGGAGGG + Intergenic
1149860373 17:60118982-60119004 CTGGGGCTGGGGTGTGGGGAGGG - Intergenic
1150004696 17:61462534-61462556 ATAGGGAGAGGGTGCAGGGAGGG + Intronic
1150161651 17:62903027-62903049 CAGGGGATAGGGTGTGGTCAGGG - Intergenic
1150303351 17:64064152-64064174 CTGTGGAGAGGGTGCAGTGAGGG + Intronic
1150422378 17:65049692-65049714 CTGGGGAAAGGGAGGGGGCATGG + Intronic
1150721100 17:67615039-67615061 CTGGGGCTAGCATGTGGGGAGGG - Intronic
1150790138 17:68196542-68196564 GTGGGGGTAGGGGGTGGGGAAGG + Intergenic
1151177636 17:72301807-72301829 CTGGGGTCAGGGTGGGGGCAGGG + Intergenic
1151438684 17:74114463-74114485 CTGGGGAGGGGGTGGGGGCAGGG + Intergenic
1151499204 17:74478142-74478164 CTGGGGAGAGGGGGCAGGGGAGG - Intronic
1151605355 17:75131879-75131901 CTAGGGTTCGGGTGCAGGGACGG + Intergenic
1152404562 17:80089233-80089255 CTGTGGAAAGGGTGCGGAGCAGG + Intronic
1152861335 17:82698373-82698395 CTGGGGAGGGGGTGCGGGTGGGG - Intronic
1203173739 17_GL000205v2_random:175638-175660 CTGGGGAGAGGTTGCCTGGAGGG + Intergenic
1153210548 18:2758796-2758818 CAGGGGATGGGGTGGGGGCAGGG - Intronic
1153769080 18:8401033-8401055 CTGGGGGTGGGGAGAGGGGATGG - Intronic
1154236246 18:12608967-12608989 ATGGGGGTGGGGTGTGGGGATGG + Intronic
1154299553 18:13181172-13181194 TTGGGGACAGGGTGGGGGGCAGG - Intergenic
1155531364 18:26770328-26770350 CAGGGGCTAAGGTGGGGGGAGGG - Intergenic
1156029918 18:32700796-32700818 CTGGGGAGAGGGAGCGGCAAGGG + Intronic
1156449879 18:37260976-37260998 GAGGGGACAGGGTGAGGGGAGGG - Intronic
1157300730 18:46477314-46477336 CTGGGGGTAGGGTGGGGAGCAGG + Intronic
1157468830 18:47971895-47971917 CAGGGGATGGGGTAGGGGGAAGG - Intergenic
1157810083 18:50688731-50688753 CTGGGGAAAGGGTGGGAGGGGGG + Intronic
1158427612 18:57353395-57353417 CTGCGGACAGGGCGCGGGGAGGG - Intronic
1158721952 18:59933009-59933031 CTGGGGATGGGGACTGGGGAGGG - Intergenic
1159453564 18:68633036-68633058 CAGGGGAAAGGGTGGGAGGAGGG - Intergenic
1159947901 18:74457402-74457424 CTGGGGCGGAGGTGCGGGGAGGG + Intronic
1160369183 18:78357151-78357173 CTGGGGTGAGGCTGTGGGGAGGG - Intergenic
1160434299 18:78833609-78833631 CTGGGGAGAGGGTGCCGGGTTGG - Intergenic
1160563889 18:79775052-79775074 CTGGGGAGAGGGTTGGTGGAAGG + Intergenic
1160974449 19:1785728-1785750 CTTGGGATTGGGTGGGGGGCGGG + Intronic
1160981026 19:1816645-1816667 CTGGGGAGAGGCGGCTGGGAGGG + Intronic
1161981694 19:7633375-7633397 CTGGGGGTGGGGTGGGGGCAGGG + Intronic
1162086882 19:8254655-8254677 CTGGGGGTGGGGCGTGGGGATGG + Intronic
1162145537 19:8610740-8610762 CAGGGGAGGGGGCGCGGGGAAGG + Intergenic
1162303884 19:9859800-9859822 CTGGGATTGGGGTGGGGGGAAGG - Intronic
1162332549 19:10039106-10039128 GTGGGGATAGGGGGTGGGGCTGG - Intergenic
1162402204 19:10453169-10453191 CTGGGGAGGGGGTGCCGGGCAGG - Intronic
1162793064 19:13072905-13072927 TTGGGGAGAGGGTGGGGTGAAGG + Intronic
1162824483 19:13243254-13243276 TCAGGGATAGGGTGAGGGGAAGG + Intronic
1162982490 19:14248614-14248636 CTGGGGAGGGGGAGAGGGGATGG - Intergenic
1163113914 19:15178091-15178113 CTGGGGGTCGGGTTTGGGGAGGG + Intronic
1163210760 19:15838463-15838485 CTGGGGATTGGGGGTGGGGGTGG + Intergenic
1163304674 19:16470497-16470519 CAGGGGGTGGGGGGCGGGGAAGG - Intronic
1163685602 19:18710156-18710178 CTGGAAATGGGGTGGGGGGAAGG - Intronic
1164676375 19:30104304-30104326 CTGTGGAGAGGGTGTGTGGAGGG - Intergenic
1164879063 19:31715482-31715504 CTGGGGAGGGGGCGCCGGGAAGG - Intergenic
1164986534 19:32652574-32652596 CCGGGGGTAGGGTGTGGGGTTGG + Intronic
1165149910 19:33754091-33754113 GTGGGGAGATGGTGTGGGGATGG - Intronic
1165425067 19:35740962-35740984 CAGGTGATAGGGAGCGGGGAAGG - Intronic
1165698456 19:37919071-37919093 CAGTGGATGGGGTGTGGGGAAGG + Intronic
1165773080 19:38389485-38389507 CTGGGGCTGGGGGGCGGGAAGGG + Intronic
1165792829 19:38502349-38502371 GTGGGCATAGGGTGGGAGGAGGG + Intronic
1165855954 19:38879376-38879398 GTGGGGAGAGGGTCCAGGGATGG + Intronic
1165928506 19:39342148-39342170 TTGGGGCTGGGGGGCGGGGAAGG - Intronic
1165930745 19:39356861-39356883 CTGGGGCCAGGGTCGGGGGACGG - Exonic
1165947010 19:39449598-39449620 TGGGGGAGAGGGGGCGGGGATGG + Intronic
1166046273 19:40232854-40232876 CTGGGGAGAGGGAGGGGTGAGGG + Exonic
1166055434 19:40285350-40285372 CTGGGGGGAGGGGGCGGGGGGGG - Exonic
1166705598 19:44906327-44906349 GTGGGGAGGGGGTGGGGGGATGG + Intronic
1167074219 19:47239408-47239430 CTGGGGAGAGGGAGTTGGGAAGG + Intergenic
1167120205 19:47512281-47512303 CTGGGGAGTGGGGCCGGGGAGGG - Intronic
1167621796 19:50564873-50564895 TTGGGGATTGGGGGCGGGGGTGG - Intronic
1168165991 19:54548415-54548437 CTGGGGGTAGGGGAAGGGGAGGG - Intergenic
1168327024 19:55543775-55543797 CTGAGGTTAGGGTGTGGGCATGG - Intronic
1168421944 19:56210200-56210222 CTGGGGATGCTGGGCGGGGAGGG - Intergenic
925289135 2:2735173-2735195 TCGGGGAAAGGGTGCTGGGAAGG + Intergenic
925719675 2:6814706-6814728 CTGGGGATAGAGAGAGGGTAGGG + Intergenic
925878916 2:8334174-8334196 CAGCGGGTTGGGTGCGGGGAGGG + Intergenic
926515057 2:13832974-13832996 CTGGGGCAGGGGTGGGGGGAGGG + Intergenic
927823017 2:26285677-26285699 CTGGGGGTGGGGAGTGGGGAGGG + Intronic
927935215 2:27072258-27072280 CGGGGGGTAGGGTGGAGGGAGGG - Intergenic
928687346 2:33762178-33762200 CTGGGGAGAGGGAGAGGGGGAGG + Intergenic
929440716 2:41964207-41964229 CTGGGGATGGGGTGGGGGAGGGG - Intergenic
929453503 2:42051315-42051337 GTGGGGAGAGGTTGAGGGGAGGG - Intronic
929701572 2:44167901-44167923 CTGGGGAGGTGTTGCGGGGAGGG - Intergenic
930570820 2:53084626-53084648 CTGGGGATTTGGTGGTGGGAAGG + Intergenic
931168693 2:59779011-59779033 CTGGGGATTGGGGGAGTGGAGGG + Intergenic
931244539 2:60481226-60481248 TTGGGAATGGGGTGCTGGGAGGG - Intronic
931580533 2:63767001-63767023 CTGGGGATGGGGTGAGGGTGGGG - Intronic
932456424 2:71852537-71852559 CTGGGGACGGGAGGCGGGGAGGG + Intergenic
933171250 2:79128279-79128301 CTGGGGATAGGGTAGGGTGGGGG + Intergenic
933695326 2:85213140-85213162 CTGTGGCTGGGGTGGGGGGAGGG + Intronic
933737108 2:85504076-85504098 CTGGGGCAAGGGTGCGGGGCAGG + Intergenic
933791616 2:85888329-85888351 CTGCAGAGAGGGTGCAGGGAAGG + Intronic
934045515 2:88170264-88170286 CTGGGGATGGGGCGGGGGGCGGG - Intergenic
934573460 2:95385789-95385811 CTGGGCAGCGGGTGAGGGGAGGG - Exonic
934578985 2:95423221-95423243 CGGGGGAAAGGGTGGGAGGAGGG + Intergenic
934600462 2:95653482-95653504 CGGGGGAAAGGGTGGGAGGAGGG - Intergenic
934712967 2:96527656-96527678 CTGGGGGTGGGGAGGGGGGAGGG - Intergenic
934926415 2:98384767-98384789 CTGGGGCTGGGGTGTGGGCAAGG + Intronic
936154585 2:110039831-110039853 CTGGGGATGGGGCAGGGGGAGGG + Intergenic
936190098 2:110331583-110331605 CTGGGGATGGGGCAGGGGGAGGG - Intergenic
936533820 2:113295543-113295565 CGGGGGAAAGGGTGGGAGGAGGG - Intergenic
936574575 2:113642378-113642400 CTGGGGGGAGGGGGTGGGGAAGG - Exonic
937373542 2:121319528-121319550 CTGGGAATTGGGTGAGGGGCAGG - Intergenic
937819744 2:126296174-126296196 CTGGGGATTGGGTTTAGGGAGGG + Intergenic
937883698 2:126886371-126886393 CCGGGGTTAGGGGGCTGGGAGGG - Intergenic
937924048 2:127154127-127154149 CGGGGAGTAGGGTGCAGGGATGG - Intergenic
937986376 2:127639951-127639973 CTGGGGATATGGTGGGGACAAGG - Intronic
938262007 2:129903164-129903186 CTGGGGAGAGAATGAGGGGATGG - Intergenic
938275931 2:130022203-130022225 TGGGGGATGGGGTGAGGGGAGGG + Intergenic
938391489 2:130910055-130910077 CTGGGGGTGGGGTTAGGGGAGGG + Intronic
939629849 2:144517558-144517580 CTGGGGGTGGGGGGCGGGGAGGG - Intronic
939633824 2:144557357-144557379 ATGGGGAAAGGGTGAGGGGGTGG - Intergenic
939969535 2:148644555-148644577 CCGGGGAGAGGGGGCGGGGGCGG - Intronic
941188216 2:162343998-162344020 GTGGGGCTAGGCTGCGGGAAGGG + Intronic
941858437 2:170253881-170253903 CTGGGGACGGGGGGCGGGGGCGG + Intronic
942463023 2:176182349-176182371 CAGAGCAGAGGGTGCGGGGAGGG + Intergenic
942573762 2:177340799-177340821 CTGGGGTTAGGGTGGAGGGAGGG + Intronic
943013903 2:182487646-182487668 CTGTGGTTGGGGTGTGGGGATGG + Intronic
943331863 2:186569484-186569506 CGGGGGGTGGGGTGGGGGGAGGG + Intergenic
943435951 2:187866461-187866483 CTGGAGATACGGTGCGGGGGTGG + Intergenic
944026941 2:195181880-195181902 GTGGGGGTGGGGTGGGGGGAGGG - Intergenic
944569776 2:201032400-201032422 CTGAGGATAGGATGTGGGGAAGG - Intronic
944894053 2:204145980-204146002 CTGGGGAGACGGGCCGGGGAGGG - Intergenic
945918118 2:215726144-215726166 GTGGGGACAGGGAGAGGGGAGGG + Intergenic
946030485 2:216699884-216699906 CAGGGAAGAGGATGCGGGGATGG - Intergenic
946184789 2:217974389-217974411 CTGGGGAGAGGCTGAGGGGATGG - Intronic
946409592 2:219509504-219509526 CTGGGGAAGGGGAGCGGGGGTGG - Intergenic
946625814 2:221611194-221611216 CTGGGGAGAGAGGGCTGGGATGG + Intergenic
946976173 2:225154035-225154057 CTGGGGAAAGGTTGCAGAGAAGG - Intergenic
947486566 2:230555305-230555327 TTGGGGGTGGGGTGAGGGGAAGG + Intergenic
947931415 2:233968217-233968239 CTTGGGAGGGGGTGCGGGGGTGG - Intronic
948085268 2:235242165-235242187 CAGGTGCTGGGGTGCGGGGATGG - Intergenic
948401036 2:237685665-237685687 CTGGGTGTGGGGAGCGGGGAGGG - Intronic
948645026 2:239399398-239399420 CTGGGGAGAGGGAGGGTGGAAGG - Intronic
948746210 2:240095859-240095881 CAGGGGCCAGGGTGCAGGGACGG + Intergenic
948914431 2:241025287-241025309 CTGGGGTGGGGGTGTGGGGATGG - Intronic
948946684 2:241224074-241224096 CTGGGGAGAGGGTTGGGGGCAGG - Intronic
1168809489 20:695082-695104 GTGGGGAGAGGGTGCGTGGCTGG - Intergenic
1168883269 20:1225686-1225708 CCGGGGGCAGGGGGCGGGGAAGG - Intergenic
1169153150 20:3306256-3306278 CAGAGGATGGGGTGTGGGGAGGG - Intronic
1169975218 20:11317994-11318016 TTGGGGAAAGGGTGGGAGGAGGG - Intergenic
1170828098 20:19814369-19814391 CTGGGGAGGGGGTGGGAGGAGGG - Intergenic
1171392218 20:24808959-24808981 CTGGGGACAGGGTGGGGTGAGGG + Intergenic
1172022644 20:31925189-31925211 CTAGGGATAGGGTGGGGGCAGGG + Intronic
1172588301 20:36100328-36100350 CTGGGGACAAGGTGGGGAGAGGG - Intronic
1172811763 20:37653181-37653203 CAGGGGCTAGGGAACGGGGAGGG + Intergenic
1173021235 20:39269465-39269487 CTGGGGATAGGGTCAGGAGCTGG + Intergenic
1173754151 20:45500189-45500211 CTTGGGAAAGGGTGCAGGAAGGG - Intergenic
1174263743 20:49316683-49316705 CTGGGGTTAGGCTGGAGGGAGGG - Intergenic
1174403877 20:50291465-50291487 CTGGGACTGGGGTGAGGGGAAGG - Intergenic
1174924510 20:54742779-54742801 GTGGGGGTAGGGGGTGGGGAGGG + Intergenic
1175727527 20:61329839-61329861 CGGGGGATGGGGTGGGGGGGAGG - Intronic
1175755438 20:61526646-61526668 CCAGGGATGGGGTGGGGGGAGGG - Intronic
1176108407 20:63400092-63400114 CTGTGGACCGGGTGTGGGGACGG - Intergenic
1176293540 21:5058890-5058912 GAGGGGATAGGGGGAGGGGAAGG - Intergenic
1176329730 21:5537284-5537306 CTGGGGAGAGGTTGCCTGGAGGG + Intergenic
1176398027 21:6283667-6283689 CTGGGGAGAGGTTGCCTGGAGGG - Intergenic
1176439130 21:6705437-6705459 CTGGGGAGAGGTTGCCTGGAGGG + Intergenic
1176463392 21:7032506-7032528 CTGGGGAGAGGTTGCCTGGAGGG + Intergenic
1176486953 21:7414285-7414307 CTGGGGAGAGGTTGCCTGGAGGG + Intergenic
1176551856 21:8226571-8226593 GTGGGGAGGGGGTGCGGGGTGGG + Intergenic
1176554026 21:8245313-8245335 CTGGGGAGGGGGTGGGGGGAAGG - Intergenic
1176570765 21:8409570-8409592 GTGGGGAGGGGGTGCGGGGTGGG + Intergenic
1176572948 21:8428337-8428359 CTGGGGAGGGGGTGGGGGGAAGG - Intergenic
1176578674 21:8453717-8453739 GTGGGGAGGGGGTGCGGGGTGGG + Intergenic
1177729692 21:25012376-25012398 CGGGGGATAGGGGGAAGGGAGGG - Intergenic
1178486237 21:33021423-33021445 CTGGGGTGGGGGTGTGGGGAAGG + Intergenic
1178824688 21:36005066-36005088 CGGGGGAAGGGGTGCGGGGGGGG + Intergenic
1179473841 21:41631014-41631036 CAGGGGACAGGGTGAGGGGCAGG - Intergenic
1179486820 21:41715855-41715877 CTGGGGGTAGGGAGTGGGGCAGG + Intergenic
1179863720 21:44204758-44204780 GAGGGGATAGGGGGAGGGGAAGG + Intergenic
1179905412 21:44420249-44420271 ATGGGGACAGGGTGGGTGGAGGG - Intronic
1179985822 21:44919821-44919843 GGGGGGATTGGGTGTGGGGACGG + Intronic
1181022823 22:20112557-20112579 CTGGGCCTAGGATGAGGGGAAGG + Exonic
1181099879 22:20531967-20531989 CTGGGGAGAGTGTGTGGGGCAGG + Intronic
1182094011 22:27614256-27614278 CTGGGGCAGGGGGGCGGGGACGG - Intergenic
1182293369 22:29298940-29298962 GTGGGGATGGGGTGAGGGAAGGG - Intronic
1182355255 22:29719932-29719954 CTGGGGGTGGGGAGCGCGGAGGG + Intergenic
1182373462 22:29828736-29828758 ATGGGGAAAGGGTGGGAGGAAGG + Intronic
1182422266 22:30254351-30254373 CTGGGGGTAGGGGGCTGGGGTGG - Intergenic
1182424957 22:30266919-30266941 GTGGGGATGGGGAGGGGGGAGGG + Intergenic
1182604096 22:31489893-31489915 CCGGGGCCAGGGTGCGTGGAGGG - Intronic
1183094133 22:35542086-35542108 CTGGGGACAAGGGGAGGGGAGGG - Intronic
1183406001 22:37630993-37631015 CTGGGGACACGGTGTGGAGAAGG - Exonic
1183471531 22:38009674-38009696 CTAGGGAGAGGGTGGGGTGAAGG - Intronic
1183493123 22:38127279-38127301 CCGGGGACAGGGTGCAGGGGAGG + Intronic
1183629021 22:39021962-39021984 CTTAGGAGAGGGTGTGGGGAGGG + Intronic
1183632452 22:39041411-39041433 CTTAGGAGAGGGTGTGGGGAGGG + Intronic
1183638274 22:39077807-39077829 CTTAGGAGAGGGTGTGGGGAGGG + Intronic
1184145324 22:42607122-42607144 CTGGGGAGAGGGGGAGGGGGAGG - Intronic
1184194293 22:42916407-42916429 GTGGGGATGGGGGGTGGGGAAGG + Intronic
1184662656 22:45972444-45972466 CTGGGGCTGGAGTGCGGGGCGGG + Intronic
1203256877 22_KI270733v1_random:143493-143515 GTGGGGAGGGGGTGCGGGGTGGG + Intergenic
1203259031 22_KI270733v1_random:162351-162373 CTGGGGAGGGGGTGGGGGGAAGG - Intergenic
950263401 3:11558451-11558473 ATGGGGGTGGGGTGGGGGGAAGG - Intronic
950485832 3:13273609-13273631 CTGGGCAGAGGCTGCTGGGATGG - Intergenic
950556369 3:13698634-13698656 CTGGGGTCTGGGGGCGGGGAGGG - Intergenic
950629101 3:14269777-14269799 CTAGGGATAGGGTTGGGGGAAGG - Intergenic
950791196 3:15473820-15473842 CTGGGGAGAGGGTGGCAGGATGG - Intronic
950951529 3:17004995-17005017 GTGGGGCTAGGGTGTGGGCATGG - Intronic
950962300 3:17119248-17119270 GTGGGGATGGGGTGGTGGGAGGG - Intergenic
951588133 3:24235959-24235981 GTGGGGACAGGGTGGGGTGAGGG - Intronic
953328407 3:42031971-42031993 CATGGGTTAGGGGGCGGGGAAGG + Intronic
954506049 3:51074673-51074695 CTGGGGGTGTGGTGAGGGGAGGG + Intronic
955421066 3:58738334-58738356 TTGGGGGTGGGGTGAGGGGAGGG - Intronic
955439157 3:58936773-58936795 GTGGGGTTAGGGGACGGGGAGGG + Intronic
955769160 3:62372167-62372189 ATGGGGATAGGGAGCCGGGTGGG + Exonic
955935946 3:64102667-64102689 CTGGGGCCAGGGGGTGGGGATGG - Intronic
956413656 3:69004714-69004736 TTGGGGAATGGGTGGGGGGATGG - Intronic
960020544 3:112947111-112947133 CTGGGGTTAGTGGGCAGGGAAGG + Intronic
960251818 3:115463792-115463814 CGGGGGAGGGGGTGGGGGGAGGG + Intergenic
960618632 3:119618676-119618698 CTGGGGAAAGGATGCCAGGAAGG + Intronic
961025912 3:123557303-123557325 CTGGGGATAAGGGGAGGGGGTGG - Intronic
962040308 3:131700360-131700382 TGGGGGATGGGGTGCAGGGAGGG + Intronic
962171790 3:133108836-133108858 GTGGGGTGAGGGTGGGGGGAGGG + Intronic
962327442 3:134447640-134447662 CTGGAGATTGGGTGGGGTGAGGG + Intergenic
962980909 3:140489204-140489226 ATTGGGATGGGGTGCAGGGAAGG + Intronic
963732951 3:148990517-148990539 CTGGGGATGGGGAGCAGAGAAGG + Intergenic
963956485 3:151260069-151260091 CTGGGGATATGGTGATGGGTGGG + Intronic
964262780 3:154858514-154858536 CTCAGGATAGGGAGTGGGGATGG - Intergenic
964358463 3:155870974-155870996 CTGGGGGAAGGGGGTGGGGAAGG - Intronic
964801756 3:160565454-160565476 CTGGGGTTAGGGCGGGGGGGCGG - Exonic
965499460 3:169440539-169440561 TTGGGGATGGGGTGGGAGGAGGG + Intronic
965828100 3:172751002-172751024 CTGGGGGTGGGGTGCGGCGAGGG - Intronic
966047641 3:175572036-175572058 GTGGGGATGGGGTGGGGGAATGG + Intronic
966058997 3:175732901-175732923 CGGGGGGTAGGGTGGTGGGAGGG + Intronic
966355940 3:179079167-179079189 CTGGGGGTAGGGGGAGGGGGCGG - Intergenic
966882098 3:184356290-184356312 CTGAGGATTGGGAGTGGGGAGGG - Intronic
966975231 3:185077115-185077137 CATGGTATAGGGTGCGGGGTGGG + Intergenic
967715192 3:192754393-192754415 TTGGGGATTGGGGGCGGGGGTGG - Intronic
968088734 3:195886510-195886532 GTGGGGACAGGCTGTGGGGAAGG + Intronic
968107135 3:196009268-196009290 CAGGGGGCAGGGTGTGGGGAGGG - Intergenic
968225150 3:196968636-196968658 CAGAGGAGCGGGTGCGGGGAGGG - Intronic
968573371 4:1353938-1353960 CTGGGGCTGGGGGGCGGGGGCGG - Intronic
968650287 4:1757714-1757736 GTGGGGGTTGGGTGGGGGGATGG - Intergenic
969182132 4:5450326-5450348 CTGTGGATATGGTCAGGGGAAGG - Intronic
969600146 4:8171379-8171401 CTGGGGAGAGGGAGCCAGGAGGG - Intergenic
969651256 4:8469604-8469626 CTGGAGATGGAGAGCGGGGATGG + Intronic
970006261 4:11413639-11413661 CAGGGTATAGGGTGTGGAGAGGG + Intronic
970491433 4:16579004-16579026 CTGGAGATAGAGAGTGGGGATGG + Intronic
970615868 4:17767697-17767719 CGGGGGGTGGGGGGCGGGGAGGG - Intronic
971345758 4:25810364-25810386 CTGGTGAGAGGCTGCAGGGATGG - Intronic
972166182 4:36287124-36287146 CTGGGGAAAGGGTGGGAGGGAGG - Intronic
973635965 4:52862259-52862281 GTGGGGAGAGGGGGCGGGGCCGG + Intergenic
973728036 4:53795471-53795493 CGGGGGATGGGGTGGGGGGAGGG + Intronic
973916288 4:55637331-55637353 CGGGGGAGAGGGGGCGGGGAGGG - Intergenic
974434352 4:61837865-61837887 CTAGGGATAGGGTGGGGAGCTGG + Intronic
975652772 4:76610987-76611009 CTGTGGATAGGGATGGGGGAGGG + Intronic
976031391 4:80758434-80758456 ATGGGCATAGGATGGGGGGAAGG + Intronic
976579691 4:86721676-86721698 CGGGGGAGAGGGAGAGGGGAAGG - Intronic
977460994 4:97325151-97325173 GTGGGGTAAGGGTGAGGGGAGGG - Intronic
977705725 4:100068093-100068115 TTGGGGCTAGGGTAGGGGGATGG + Intergenic
979723534 4:123932699-123932721 CTGGGGGAAGGTTGGGGGGAGGG + Intergenic
981422784 4:144570560-144570582 CTGGGGAAGGGGTGCATGGATGG + Intergenic
982317692 4:154048060-154048082 TTGGGGAAAGGGTGGGTGGAGGG + Intergenic
982361944 4:154527706-154527728 CTGGGGCTTGGGGGCGGGTAGGG + Intergenic
983019424 4:162656460-162656482 CGGGGGGTGGGGTGGGGGGAGGG + Intergenic
984368279 4:178827444-178827466 TTGGGGGTGGGGTGGGGGGAGGG - Intergenic
984806789 4:183758540-183758562 CTGGGGACGGGGCGTGGGGAAGG + Intergenic
984891583 4:184498772-184498794 CTGGGGACTGGGCGCAGGGAGGG + Intergenic
984991385 4:185384890-185384912 CGGGGGACGGGGGGCGGGGAGGG - Intronic
984999649 4:185471193-185471215 CTGGGGCGGGGGGGCGGGGAGGG + Intronic
985324916 4:188756001-188756023 CTGGTGGCAGGGTGGGGGGAGGG + Intergenic
985634073 5:1027490-1027512 CAGAGGAGAGGGAGCGGGGAGGG - Intronic
985676247 5:1232692-1232714 CTGGGCAGAGGGAGCTGGGAAGG + Intronic
985901539 5:2798996-2799018 CTGGGACGGGGGTGCGGGGAGGG + Intergenic
986045485 5:4033287-4033309 CAGGGGATGGGGTGGGGGAAAGG - Intergenic
986270711 5:6228313-6228335 CTGGGGCTAGGAAGAGGGGAGGG + Intergenic
986307868 5:6528938-6528960 CTGGGGAGAGGGTACCTGGAAGG - Intergenic
986331047 5:6716253-6716275 CTGGGGATCTGGGGCAGGGACGG + Intronic
986432810 5:7698531-7698553 TTGGGGAGGGGGTGAGGGGAGGG - Intronic
986739248 5:10691679-10691701 CTGAGGATATGGGGCGGGCAGGG - Intronic
986752127 5:10796681-10796703 CTGGGGGTGGGGTACAGGGATGG - Intergenic
987005162 5:13703146-13703168 CTGGGTAGAGGGTGTGGGGTGGG - Intronic
987258345 5:16179695-16179717 CTGGGGCTAGGGGGCGGGACGGG + Exonic
987290480 5:16504049-16504071 TTGGGGATGGGTTGGGGGGAGGG - Intronic
988235257 5:28535840-28535862 GTGGGGTTGGGGTGGGGGGAGGG - Intergenic
988687086 5:33535748-33535770 CTGGGGATTGGATGTGAGGAGGG + Intronic
988882832 5:35522256-35522278 CTGGGGAAAGGGTGGGAGGTGGG + Intergenic
989351660 5:40493802-40493824 CGGGGGAAAGGGTGGGAGGAGGG - Intergenic
989550215 5:42726336-42726358 CTGGGGATGGGAAGTGGGGAAGG - Intergenic
989687784 5:44109869-44109891 ATGGGCACAGGATGCGGGGAGGG - Intergenic
990165403 5:52989014-52989036 CTGGCGACAGGCTGCGGGGGCGG + Intergenic
990238591 5:53794387-53794409 TTGGGGTTGGGGTGCAGGGAGGG - Intergenic
990549737 5:56862470-56862492 TTGGGGGTGGGGTGTGGGGAAGG - Intronic
990956412 5:61344530-61344552 TTGGGGATGGGGTGAGGGAAGGG + Intronic
991166951 5:63574720-63574742 ATGGGGGTGGGGTGGGGGGAAGG - Intergenic
991370176 5:65910371-65910393 CGGGGGAAAGGGTGAGAGGAGGG + Intergenic
991529383 5:67598477-67598499 GTGGGGTTGGGGTGGGGGGAGGG - Intergenic
992249755 5:74865805-74865827 GTGGGGAGAGGGCGAGGGGAGGG + Intronic
993516998 5:88850077-88850099 ATGGGGTTGGGGGGCGGGGAGGG - Intronic
993737695 5:91497655-91497677 TTGGGCATAGGGTACGAGGAAGG - Intergenic
993903850 5:93602578-93602600 CTGGGGCTGGCGTGCAGGGAAGG + Intergenic
994705957 5:103206886-103206908 CTGCGGACAGGGAGCAGGGAAGG + Intronic
995024722 5:107406709-107406731 CTGGGGACAGGAGGCTGGGAGGG - Intronic
995846506 5:116499423-116499445 CGGGGGGTGGGGTGCGGGGAGGG + Intronic
996272914 5:121630029-121630051 CGGGGGAAAGGGTGGGGGGTGGG - Intergenic
996621898 5:125515296-125515318 CAGGGTATAGGGTGAGAGGAAGG + Intergenic
998137596 5:139682314-139682336 CTGGGGCTGGGGTTGGGGGAGGG - Intronic
998449430 5:142222883-142222905 CTGGGGGTGGGGTGTGGGGTGGG - Intergenic
998461396 5:142312889-142312911 CTGGGGAGAGGGTAGGGGAAAGG - Exonic
998875356 5:146593674-146593696 CTGGGTTTGGGGTGAGGGGAAGG + Intronic
999179516 5:149659224-149659246 CTGGGGACAGGATGTTGGGAAGG + Intergenic
1000873195 5:166602940-166602962 CTGGAGATAGGTTGTGGTGACGG - Intergenic
1001085182 5:168695313-168695335 CTGGGAATAGTGTTCGAGGATGG + Intronic
1001430741 5:171660034-171660056 CTGGGGATGGGGGGTGGGGAAGG - Intergenic
1002093322 5:176817274-176817296 ATGGGGAGGGGGTGGGGGGAAGG + Intronic
1002253963 5:177945372-177945394 CTGAGGACAGGGTGCAGGGTGGG + Intergenic
1002364106 5:178696790-178696812 CTGGGGAGAGGGTGGAGAGAGGG + Intergenic
1002442995 5:179273998-179274020 CTGGGGATGGGGTGGTGGGGTGG - Intronic
1002594764 5:180314751-180314773 CTGCGGTGAGGGTGCGGGAAAGG + Intronic
1003218415 6:4135728-4135750 CCGGGGCTTGGGTGCGGGGCGGG + Intergenic
1003267286 6:4576977-4576999 CAGGGGATAGGGAGCTGGGATGG - Intergenic
1003405077 6:5821312-5821334 CTGGGGATGGGGAGGAGGGAAGG - Intergenic
1004114233 6:12750233-12750255 GTGGGGAGAGGGGGCGGGGCTGG + Intronic
1004562323 6:16761823-16761845 CTCGGGATGGGGTGCGGGGGAGG + Intergenic
1004878191 6:19977547-19977569 GTGGTGATGGGGTGGGGGGAGGG - Intergenic
1004887797 6:20068614-20068636 CGGGAGATAGGGTGAGGGGAAGG - Intergenic
1005842221 6:29751078-29751100 CTGGGGTTGGGGGGCGGGGGAGG + Intergenic
1005863164 6:29916869-29916891 CTGGTGATAGGGTTAGTGGAAGG - Intergenic
1006084802 6:31587973-31587995 CTGGGGACAGGGAAGGGGGAGGG + Intronic
1006203517 6:32318731-32318753 CTGGGGCTATGGTGTGGAGAGGG + Intronic
1006617385 6:35339735-35339757 GTGGGGAGAGGGAGCGGGGGAGG - Intergenic
1006620531 6:35360839-35360861 CAGGGGCTGGGGTGCAGGGATGG + Intronic
1006918725 6:37613845-37613867 CTGGGAATAGGGTGGGGGATTGG - Intergenic
1007079338 6:39087629-39087651 CTGGGGAAAGGTTTTGGGGAGGG - Exonic
1007230697 6:40345833-40345855 CTGGCGTTGGGATGCGGGGAGGG - Intergenic
1007415885 6:41690962-41690984 GTGGGGACAGGGTGGGGGGCAGG + Intronic
1008057759 6:46962886-46962908 CTGGGGAAAGGATGTGGGGCTGG - Intergenic
1008189414 6:48436589-48436611 CAGGGGATGGGGTGGGGGGAGGG - Intergenic
1008595694 6:53039630-53039652 CTTGGGATGGGGTGCTGGCATGG + Intronic
1010046232 6:71447308-71447330 CTGGGGAGAAGGGGCAGGGAGGG + Intergenic
1010281350 6:74026970-74026992 CATGGGATGGGGTGGGGGGAAGG - Intergenic
1010849166 6:80750218-80750240 GTGGGGTTGGGGTGGGGGGAGGG + Intergenic
1011730925 6:90262389-90262411 CTGGGAATGGGGCGTGGGGATGG - Intronic
1012062960 6:94511475-94511497 CCGGGGGTGGGGCGCGGGGAGGG - Intergenic
1012403122 6:98861221-98861243 GTGGGGATAGGGGTAGGGGAAGG + Intergenic
1012474902 6:99607498-99607520 CTGCGGACAGCGTGCGGGGGTGG - Intronic
1013756460 6:113467539-113467561 ATGGGGACAGGGAGAGGGGAGGG - Intergenic
1014021779 6:116599174-116599196 CTGGGGATAGAGTGTGTGTATGG - Intergenic
1014731657 6:125038980-125039002 CAGGGGATGGGGTGGAGGGAGGG - Intronic
1015568156 6:134595088-134595110 CTGGGTGCAGGGTGCTGGGAAGG + Intergenic
1015800150 6:137052343-137052365 CTGGGGATAGGGCTGGGGGTGGG - Intergenic
1015853784 6:137602507-137602529 CAGGGTATGGGGGGCGGGGAGGG + Intergenic
1016937597 6:149459027-149459049 CTGGGGTGAGGGTGTGGGGGCGG - Intronic
1017036931 6:150275330-150275352 CTGGGGATGGGGTGGGGACAGGG - Intergenic
1017539991 6:155391158-155391180 CTGGGGAAGGGTAGCGGGGAGGG + Intergenic
1017665912 6:156720103-156720125 CCGGGGAGCGGGTGCGGGGCGGG - Intergenic
1017935178 6:158999383-158999405 CTGGGGATGGGGTGCAAGTATGG + Intronic
1018273155 6:162102182-162102204 CTGGGGGATGGGTGGGGGGACGG - Intronic
1018387916 6:163321779-163321801 GCGGGGAGAGGGTGCGGGGTCGG - Intergenic
1018454714 6:163941538-163941560 CTGGGGTTGGGGTGTGGGGATGG + Intergenic
1018690227 6:166338668-166338690 CTGGGGAGAGGGTGGGGAGGCGG + Intronic
1019525112 7:1477294-1477316 GTGGGGATGGGGTGGGTGGATGG - Intronic
1019563569 7:1669329-1669351 CGGGGGACAGGAAGCGGGGAGGG + Intergenic
1019647568 7:2139281-2139303 GTGGGGTGGGGGTGCGGGGAGGG - Intronic
1019709459 7:2511669-2511691 CTGGGGCTGGGGTGGAGGGAGGG - Intergenic
1019728016 7:2613606-2613628 CTGCGGAGAGAGTGCAGGGAGGG + Exonic
1020479937 7:8646917-8646939 CTGGGCATGGGGAGCTGGGAGGG + Intronic
1020815816 7:12904179-12904201 CTGGGGTGGGGGTGCAGGGAAGG + Intergenic
1021205676 7:17777021-17777043 CTGGGGATAGGGAATGAGGAGGG - Intergenic
1021708981 7:23396252-23396274 TTGGGGGTAGGGGGCAGGGAGGG + Intronic
1021779173 7:24085038-24085060 CAGGGAATAGGGTGGGGGAAGGG - Intergenic
1021792553 7:24220027-24220049 CAAGGGGTAGGGTGTGGGGAGGG + Intergenic
1022095822 7:27140606-27140628 GTGGGGAAGGGGTGCTGGGATGG + Intronic
1022171888 7:27839126-27839148 CTGGGCACAGGGTGCAGGGGAGG - Intronic
1022677262 7:32511663-32511685 CGGGAGGTAGGGTGCTGGGAAGG + Intronic
1023215260 7:37855507-37855529 CTTGGGATTTGGTGGGGGGAGGG - Intronic
1023870984 7:44262974-44262996 CCTGGGGTAGGGAGCGGGGATGG - Intronic
1025237652 7:57245494-57245516 CTGTGGATAGTGTCTGGGGAGGG - Intergenic
1025603057 7:63017535-63017557 GTAGGGAGAGGGTGCAGGGAAGG - Intergenic
1025712861 7:63927828-63927850 CTGGGGAAAGGGTGTGAGGCAGG - Intergenic
1025839845 7:65136184-65136206 CTTGGGGTGGGGTGGGGGGAGGG - Intergenic
1025883221 7:65559781-65559803 CTTGGGGTGGGGTGGGGGGAGGG + Intergenic
1025890225 7:65642825-65642847 CTTGGGGTGGGGTGGGGGGAGGG - Intergenic
1026264319 7:68783173-68783195 GTGGGGGTGGGGTGGGGGGATGG - Intergenic
1026360981 7:69600202-69600224 CTGTGGAGGGGGTGCAGGGAGGG - Intronic
1027878548 7:83802309-83802331 CTGGGGACAGGGTTGGGGGTAGG + Intergenic
1027885411 7:83898677-83898699 TGGGGGGTAGGGTGGGGGGAGGG - Intergenic
1028702391 7:93795308-93795330 CTGGGGGTGTGGTGAGGGGAGGG - Intronic
1028963288 7:96773951-96773973 CTGGGGATGGGGAGTGGGGGTGG + Intergenic
1029456334 7:100674235-100674257 GTGGGGAAAGGGGGCGGGGCGGG - Intronic
1029526784 7:101099596-101099618 CTGGGCATTGGGTGCTAGGAAGG - Intergenic
1029580610 7:101434665-101434687 ATGGGGACAGGGTGCGAGGCAGG + Intronic
1029630738 7:101748475-101748497 CTGAGGCTCGGGTGGGGGGAGGG + Intergenic
1030348341 7:108456723-108456745 CGGGGGTGGGGGTGCGGGGACGG + Intergenic
1031223761 7:119007828-119007850 ATCTGGATAGGGTGCAGGGATGG + Intergenic
1032018251 7:128393080-128393102 CTGGGGAAAGGGTTTTGGGAAGG - Intronic
1032056496 7:128688784-128688806 GTGGGGAGAGGGAGGGGGGAGGG - Intergenic
1032283872 7:130526830-130526852 GTGGGGATGGGGTTCGGGGTGGG + Intronic
1032284601 7:130531062-130531084 GTGGGGATGGGGTTCGGGGTGGG + Intronic
1032845181 7:135745868-135745890 CTGGAGGTAGGGTGGGGGTAAGG + Intronic
1032945011 7:136840324-136840346 CGGGTGACAGGGTGAGGGGAGGG + Intergenic
1033152109 7:138924538-138924560 CTAAGGACAGGGTACGGGGAGGG + Intronic
1033926280 7:146465072-146465094 CTGGGGATACGGTGATGGGCAGG - Intronic
1034263836 7:149772347-149772369 CTGGGGACTGGGGACGGGGAGGG - Intronic
1034412802 7:150950149-150950171 CTGGGTATGGGGTGGGGGGCGGG - Exonic
1034439870 7:151081137-151081159 CTGGTGAAGGGGAGCGGGGAGGG - Exonic
1034621434 7:152460200-152460222 CTGGGGCCAGGGTGAGGGCAAGG + Intergenic
1034687981 7:152990232-152990254 ATGGGGAAAGGGTGCGGGGCAGG + Intergenic
1035642370 8:1193879-1193901 CTGGGGACAGGAGGCGGGGGCGG - Intergenic
1035737455 8:1898757-1898779 GAGGGGATGGGCTGCGGGGAGGG + Intronic
1036127343 8:6075165-6075187 CTGGGGATAGGGTAAAGGGGAGG - Intergenic
1036133879 8:6140987-6141009 ATGGGAAAAGGGTGCGGGGGTGG + Intergenic
1036254035 8:7189926-7189948 CTGGGGATGGGGTGAAGGAAAGG + Intergenic
1036363457 8:8097553-8097575 CTGGGGATGGGGTGAAGGAAAGG - Intergenic
1036703649 8:11030636-11030658 CTGGGGGTGGCGTGAGGGGAGGG + Intronic
1038644046 8:29348911-29348933 CTCGGGCTAGGGAGCGGGCAGGG - Intronic
1038804661 8:30779071-30779093 CTGGGGAAGGGGTGAGGGCATGG + Intronic
1039258982 8:35750270-35750292 GTGGGGTTGGGGGGCGGGGAAGG - Intronic
1039410145 8:37348100-37348122 CTGGGGCTAGTGTGAGGGAAGGG + Intergenic
1039576196 8:38625997-38626019 CTGGGGATGGGGTGGTGGGGAGG - Intergenic
1040534540 8:48297349-48297371 CTGGGGATGGGGGTTGGGGAGGG + Intergenic
1040699343 8:50042286-50042308 CTGGGGGTGGGCTGTGGGGATGG - Intronic
1042723614 8:71849188-71849210 CTGGGGGTAGGCTGGGGAGAGGG + Intronic
1042936333 8:74062388-74062410 CCGGGGTTGGGGTGCGGGGAGGG - Intergenic
1043268991 8:78305085-78305107 CTGGGGAGGGGGTGGGGTGAGGG - Intergenic
1043376387 8:79654344-79654366 TGGGGGATAGGGAGGGGGGAAGG + Intronic
1043871472 8:85438489-85438511 TTGGGGATGGGGTGGGGGCAGGG - Intronic
1044286852 8:90419957-90419979 ATGGGCACAGGATGCGGGGAAGG + Intergenic
1044289112 8:90446959-90446981 CTGGGGATTGGGTGGAGGGAGGG - Intergenic
1044976357 8:97669526-97669548 CTGGGGATAAGTGGCGGAGAGGG - Intronic
1044992221 8:97806351-97806373 CTGGGGATAGAGAACAGGGAAGG + Intronic
1045345676 8:101291438-101291460 CTGGGGATGGGGAGAGGGGTAGG + Intergenic
1046241894 8:111507155-111507177 CAGGGGATAGGGTGGGAGGCGGG + Intergenic
1046654163 8:116874551-116874573 GCGGGGAAAGGGTGGGGGGAGGG + Intronic
1047754790 8:127910056-127910078 CTGGGAGTGGGGTGCAGGGAAGG + Intergenic
1047757312 8:127928609-127928631 TGGGGGATAGGGTGGGGTGATGG - Intergenic
1048469002 8:134690687-134690709 CTGGGGATGGGTTGAGGGGATGG - Intronic
1048586821 8:135781872-135781894 TTGGGGATAGGGAGGGGGGAAGG - Intergenic
1048822993 8:138396836-138396858 CTGGGGATAGGTCTAGGGGAAGG - Intronic
1049217794 8:141415730-141415752 GTGGGGAGAGGGTGTGGGGTGGG + Intronic
1049217805 8:141415753-141415775 GTGGGGAGAGGGTGTGGGGTGGG + Intronic
1049308098 8:141918167-141918189 AGGGGGATGGGGTGAGGGGAGGG + Intergenic
1049554165 8:143274028-143274050 GTGGGGGCAGGGTGGGGGGATGG - Intronic
1049584550 8:143426825-143426847 GTGGGGGTAGGGAGCAGGGAGGG + Intronic
1051250579 9:15154658-15154680 ATGGCGTGAGGGTGCGGGGAGGG - Intergenic
1051804064 9:20971758-20971780 CAGGGGATAGGGAGAGGGGTGGG - Intronic
1053000077 9:34573161-34573183 CTGGGCATGGGGTGAGGGGAGGG - Intronic
1053018106 9:34675625-34675647 CAGGGGATAGGACGCAGGGAAGG - Intergenic
1053050479 9:34957823-34957845 CCGGGGGTTGGGTGGGGGGAAGG - Intronic
1055054669 9:72012753-72012775 CTGGGGATGGGCTGGGGGTAAGG - Intergenic
1056133676 9:83609486-83609508 CTGGGGAAAGGGTGGGAGGGGGG + Intergenic
1056710766 9:88990855-88990877 CTGGGGGTAGAGCGCGGAGAGGG + Intronic
1056877544 9:90349310-90349332 GTGGGGAGTGGGTGTGGGGAGGG - Intergenic
1056969510 9:91190839-91190861 ATGGGCATAGGTTGCGGGGCAGG + Intergenic
1057375038 9:94513576-94513598 ATGGGGAAAGGGTACGGGGCAGG - Intergenic
1057677442 9:97146919-97146941 CTGGCCATAGGGTGGTGGGAGGG - Intergenic
1058121509 9:101144263-101144285 TTGGGGGTGGGGAGCGGGGAGGG + Intronic
1058348625 9:103994777-103994799 CAGGGGAAAGGGTGTGGGGTGGG + Intergenic
1059322355 9:113479599-113479621 CTGGGGCTGGGGTTGGGGGATGG + Intronic
1059404595 9:114092111-114092133 ATGGGGGTGGGGTGGGGGGAAGG - Intronic
1059864134 9:118495625-118495647 CGGGGGATGGGGTCCGGGGGAGG - Intergenic
1060351600 9:122866371-122866393 GTGGGGAGAGGGAGGGGGGAGGG - Intronic
1060368364 9:123043601-123043623 CTGTTGACAGGGTGAGGGGAAGG + Intronic
1060658396 9:125388362-125388384 CTGGGGAGGAGGTGCTGGGAGGG - Intergenic
1060982539 9:127802202-127802224 CTGGGAAGAGGGAGAGGGGAAGG + Intronic
1061450654 9:130665304-130665326 CTGGGGAGGGGGTGGAGGGAGGG + Intronic
1061500241 9:130997770-130997792 CCTAGGATAGGGTTCGGGGAGGG - Intergenic
1061507662 9:131040687-131040709 CTGGGGAGAGGGGGCAGGGGTGG - Intronic
1061562627 9:131415948-131415970 ATGGGGGTGGGGTGGGGGGAAGG - Intronic
1061715337 9:132515134-132515156 CTGGGGATGGGGTGGTGGCAAGG - Intronic
1061906243 9:133700540-133700562 CTGGGGATAGGGTGAGGTGTGGG + Intronic
1061906658 9:133702654-133702676 CTGGGGATGGGGTGAGGTGGGGG - Intronic
1062077983 9:134602541-134602563 CTGGGGACAGGGTGGGGGTGGGG - Intergenic
1062218202 9:135400349-135400371 CTGGGGATGGGGTGCCAGGTTGG - Intergenic
1062219297 9:135405813-135405835 GTGGGGCGGGGGTGCGGGGAGGG - Intergenic
1062464560 9:136675377-136675399 CTGGGGACTGGGAGCAGGGAGGG + Intronic
1062464601 9:136675500-136675522 CTGGGGACTGGGAGCAGGGAGGG + Intronic
1062464631 9:136675582-136675604 CTGGGGACCGGGAGCAGGGACGG + Intronic
1062475428 9:136724444-136724466 CTGGGGAGAGCGTACGGGGCTGG - Intergenic
1203786707 EBV:132318-132340 CTGGGGAGAGGGTGCCGTGCCGG - Intergenic
1203432365 Un_GL000195v1:103042-103064 CTGGGGAGAGGTTGCCTGGAGGG - Intergenic
1203473035 Un_GL000220v1:125175-125197 GTGGGGAGGGGGTGCGGGGTGGG + Intergenic
1203475222 Un_GL000220v1:144360-144382 CTGGGGAGGGGGTGGGGGGAAGG - Intergenic
1186228009 X:7422205-7422227 CAGGGGGTAGGGTGGAGGGAGGG - Intergenic
1186305697 X:8255077-8255099 CGGGGGAAAGGGTGGGGGGTGGG - Intergenic
1186344308 X:8675851-8675873 CGGGGGGTGGGGTGGGGGGAGGG - Intronic
1186862633 X:13689033-13689055 CTGGGGGACGGGCGCGGGGAAGG - Intergenic
1187066759 X:15847956-15847978 CTGTGGATAAGGAGCGAGGATGG - Intronic
1187346907 X:18473841-18473863 CTGGGGGTGGGGAGAGGGGATGG + Intronic
1187404432 X:18990013-18990035 CTGGGGATGCGGTCAGGGGATGG + Exonic
1187600602 X:20825139-20825161 CTGGGGGTAGGGAGTGGAGAAGG - Intergenic
1189224214 X:39398910-39398932 CTGGGGAGAGAGTGGGGGGTGGG + Intergenic
1189251092 X:39601203-39601225 CTGGGGTTGGGGTGGGAGGAGGG - Intergenic
1189313453 X:40036233-40036255 CAGGGGAGAGGGTGGAGGGAAGG - Intergenic
1189637873 X:43031425-43031447 ATGGGGTTGGGGTGGGGGGAGGG + Intergenic
1190478143 X:50848356-50848378 GTGGGGTTGGGGTGGGGGGAGGG + Intergenic
1190732044 X:53232986-53233008 CTGGGGCTTGGGGGCGGGGGAGG - Exonic
1190806624 X:53844098-53844120 CTGGGAGTTGGGTGCGGGGTTGG - Intergenic
1191802462 X:65096214-65096236 CGGGAGATGGGGTGGGGGGAGGG + Intergenic
1192764231 X:74125970-74125992 CTGGGTATAAGGTGAGAGGATGG + Intergenic
1193721518 X:84992086-84992108 CTTGTCATGGGGTGCGGGGAGGG + Intergenic
1193926320 X:87489727-87489749 CTGGGGGTGGGGTGGGGAGAGGG + Intergenic
1196976708 X:121166167-121166189 CTGAGGATAGGGTGGGGAGGAGG - Intergenic
1197415419 X:126166681-126166703 CAAGGGATCGGGTGCGGGGGTGG + Intergenic
1198301363 X:135336775-135336797 CTGGGAATAAGGAGAGGGGAAGG - Intronic
1198566961 X:137914854-137914876 ATGTGGGTAGGGTGAGGGGAGGG + Intergenic
1199710646 X:150466837-150466859 CTGGGAGTAAGGTGCAGGGATGG - Intronic
1199890213 X:152071528-152071550 GTGGGGGTGGGGTGTGGGGAAGG + Intergenic
1200168261 X:154052354-154052376 GTGAGGTTAGGGTGAGGGGAGGG + Intronic
1200216282 X:154369502-154369524 CTGGGGAAAGGGGGGTGGGATGG - Intronic