ID: 907701243 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 1:56790227-56790249 |
Sequence | GCTCTCCTCCACAAGCTGGA AGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | No data | |||
Summary | No data |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
907701237_907701243 | 12 | Left | 907701237 | 1:56790192-56790214 | CCTAGCATTTTGCATATACTCCT | No data | ||
Right | 907701243 | 1:56790227-56790249 | GCTCTCCTCCACAAGCTGGAAGG | No data | ||||
907701240_907701243 | -8 | Left | 907701240 | 1:56790212-56790234 | CCTGGGAGACTTCCTGCTCTCCT | 0: 1 1: 0 2: 10 3: 36 4: 322 |
||
Right | 907701243 | 1:56790227-56790249 | GCTCTCCTCCACAAGCTGGAAGG | No data |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
907701243 | Original CRISPR | GCTCTCCTCCACAAGCTGGA AGG | Intronic | ||
No off target data available for this crispr |