ID: 907701243

View in Genome Browser
Species Human (GRCh38)
Location 1:56790227-56790249
Sequence GCTCTCCTCCACAAGCTGGA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907701237_907701243 12 Left 907701237 1:56790192-56790214 CCTAGCATTTTGCATATACTCCT No data
Right 907701243 1:56790227-56790249 GCTCTCCTCCACAAGCTGGAAGG No data
907701240_907701243 -8 Left 907701240 1:56790212-56790234 CCTGGGAGACTTCCTGCTCTCCT 0: 1
1: 0
2: 10
3: 36
4: 322
Right 907701243 1:56790227-56790249 GCTCTCCTCCACAAGCTGGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907701243 Original CRISPR GCTCTCCTCCACAAGCTGGA AGG Intronic
No off target data available for this crispr