ID: 907710207

View in Genome Browser
Species Human (GRCh38)
Location 1:56873738-56873760
Sequence ACGTGCAGCCCTGTATTTCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 93
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 85}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907710207 Original CRISPR ACGTGCAGCCCTGTATTTCC TGG (reversed) Intronic
904947946 1:34213121-34213143 ACGTGGTGCCCTGTCATTCCTGG + Intronic
905168381 1:36096843-36096865 ACGTTCATCCCTGTCTCTCCCGG - Exonic
907710207 1:56873738-56873760 ACGTGCAGCCCTGTATTTCCTGG - Intronic
907964545 1:59316504-59316526 AAGGACAGCCCTCTATTTCCAGG + Intronic
910216931 1:84852545-84852567 ACGTGCACACCTGGATGTCCTGG - Intronic
919532039 1:198734209-198734231 TTGTGCAGCAATGTATTTCCTGG - Exonic
920764365 1:208817746-208817768 ACCTGCAGTCCTGCAATTCCTGG + Intergenic
923981163 1:239325824-239325846 TGATGCAGCCCTGTATTACCAGG - Intergenic
1066438717 10:35417147-35417169 ACGTGCTTCCCAGCATTTCCTGG - Intronic
1066520055 10:36207496-36207518 ACGTGCTGCCCTGCATTTTAGGG + Intergenic
1067147444 10:43703564-43703586 CCGTCCAGCCCTGTACTTCCTGG + Intergenic
1069122855 10:64589359-64589381 TGGTGCAGGCCTGTAGTTCCAGG + Intergenic
1071078275 10:81780794-81780816 ACTAGAAGCCATGTATTTCCAGG + Intergenic
1074715913 10:116218498-116218520 AGGTGCAGGTCTGTATCTCCCGG + Intronic
1075207198 10:120457643-120457665 AGGTGCAGCCCTGGATCCCCCGG - Intronic
1075711094 10:124530843-124530865 TCCTGCAGCCCTGGATTCCCTGG + Intronic
1076114301 10:127884787-127884809 AAGTGCAGCCCTGTGGTGCCTGG - Intronic
1076316148 10:129543137-129543159 ATGTGCAGCACTGTGTGTCCGGG - Intronic
1078641306 11:13099200-13099222 ACGGGCAGCCCCCCATTTCCAGG + Intergenic
1080094000 11:28382700-28382722 AGGTGCATGCCTGTAATTCCAGG + Intergenic
1085657865 11:78333134-78333156 AATTGGAGCCCAGTATTTCCGGG - Intronic
1088408318 11:109505425-109505447 ACATGCAGAACTGAATTTCCTGG - Intergenic
1091744556 12:2982748-2982770 ACCTGCTGCCCTGCTTTTCCTGG + Intronic
1092157753 12:6295387-6295409 AGGTGAGGCCCTGGATTTCCTGG + Intergenic
1095981471 12:47977001-47977023 GCCTCCAGCCCTGTGTTTCCGGG - Intronic
1097636707 12:62131438-62131460 GCCTGAAGCCCTGTAATTCCAGG - Intronic
1102855274 12:116288233-116288255 ATGTGCTGCCTTGTACTTCCAGG - Intergenic
1102939131 12:116923235-116923257 ACCTACTGCCCTGAATTTCCAGG - Intronic
1107283898 13:38767770-38767792 ATATGCAGCCCTGCAATTCCTGG + Intronic
1113424966 13:110200301-110200323 ACGTGCCAACCTGTGTTTCCTGG - Intronic
1113781171 13:112978394-112978416 ATGTGGAGCTCTGTCTTTCCTGG + Intronic
1114189222 14:20428390-20428412 TCGTTCAGCCCTTTTTTTCCTGG - Intergenic
1115273940 14:31585322-31585344 ACGTGCAGCTCTGAAGTTGCGGG + Intronic
1116860985 14:49995509-49995531 ACGTCTAGACCTGTGTTTCCTGG - Intronic
1120887875 14:89466085-89466107 AGGGGCAGCCCTGTGTTTGCTGG - Intronic
1124392296 15:29269915-29269937 CCGTGCAGCCCTGCAGGTCCGGG + Intronic
1129694987 15:77735403-77735425 AGGTTCAGCCCTGTGTGTCCAGG - Intronic
1130927702 15:88397698-88397720 ACATGCAGCCCTAAAGTTCCAGG - Intergenic
1132925404 16:2426756-2426778 ACATGCAGCCCTAAATTTGCAGG - Intergenic
1134178598 16:12029304-12029326 GCGTGCAGTACTGTATTTCATGG + Intronic
1135305340 16:21363050-21363072 GCGTGCAGTACTGTATTTCATGG + Intergenic
1135653859 16:24230448-24230470 ACGTGCACACCTGTAATCCCAGG + Intergenic
1136302083 16:29342202-29342224 GCGTGCAGTACTGTATTTCATGG + Intergenic
1138633947 16:58321631-58321653 TGGTGCAGGCCTGTAATTCCAGG + Intronic
1140873393 16:79127596-79127618 ACGTGCATGCATGTATTTGCAGG + Intronic
1145937417 17:28722995-28723017 ACGTGTAGTCCTGCATTACCAGG - Intronic
1147904912 17:43816431-43816453 ACGTGCGGCCCAGCCTTTCCAGG - Intronic
1148615852 17:48998756-48998778 ACGGGGAGCCCTTTCTTTCCTGG + Intronic
1150288974 17:63971015-63971037 ACGTGGGCCCCTGTATGTCCAGG + Intronic
1153643416 18:7174585-7174607 ACATGCAGCCCTGGATTCCAGGG - Intergenic
1157409400 18:47450892-47450914 ACGTGAAGACCTGTGTGTCCAGG - Intergenic
1159671370 18:71225124-71225146 ACTTGGAGCCATGTATTTTCTGG + Intergenic
1160100466 18:75916030-75916052 ACGGACAGCCCTGGATCTCCTGG - Intergenic
1160196254 18:76758118-76758140 CAGTGCAGCACTGTCTTTCCAGG + Intergenic
1162219313 19:9162596-9162618 ACGTGCAGTCCCGTATTCACCGG - Exonic
1167958529 19:53087459-53087481 AAGGGCAACCCTGTACTTCCTGG - Intronic
925785464 2:7428202-7428224 ACGTCCGTCCCTGTCTTTCCAGG - Intergenic
932977116 2:76616127-76616149 TGGTGCACCCCTGTAGTTCCAGG + Intergenic
933286668 2:80391718-80391740 ACGTGCTGCTCTGTCTTTCAAGG - Intronic
938705746 2:133923986-133924008 ACTTGCAGCCCTGTGTTCACAGG - Intergenic
941111525 2:161423222-161423244 ACTTGCAGTCCAGGATTTCCTGG - Intronic
942296251 2:174519844-174519866 TGGTTCACCCCTGTATTTCCAGG + Intergenic
948760110 2:240185075-240185097 GCTTCAAGCCCTGTATTTCCAGG + Intergenic
1172803002 20:37591441-37591463 CCATGCCGCCCTGTGTTTCCTGG + Intergenic
1182535710 22:31001274-31001296 TGGTGCATGCCTGTATTTCCAGG + Intergenic
949824496 3:8151219-8151241 ATTTGCAGCCCTGTGATTCCCGG + Intergenic
953242792 3:41164787-41164809 ACGTGTAGCCCTTTCTTTCAGGG + Intergenic
967452243 3:189638586-189638608 ATGTGCATTCCTGTGTTTCCTGG - Intronic
969556713 4:7916569-7916591 ACGTGAAGCCCTCTAGTCCCAGG + Intronic
974482758 4:62467834-62467856 AGGTGTAGGCCTGTATTTCTGGG - Intergenic
979085454 4:116404620-116404642 ACGGGCAGCCCTGTAATTCTTGG - Intergenic
984839946 4:184059079-184059101 ACGTGCTCCCCTGCATTTCCTGG + Intergenic
986068129 5:4256022-4256044 ACCTGCAGCCCTGTGTGGCCAGG - Intergenic
988852352 5:35192305-35192327 ACAAGGAGCCCTGAATTTCCAGG - Intronic
994279294 5:97882652-97882674 ACATGCTGCCTTGTATCTCCCGG + Intergenic
998365822 5:141630111-141630133 CCCTGCAGCCCAGTGTTTCCCGG - Exonic
999999483 5:157124081-157124103 TGGTGCACACCTGTATTTCCAGG - Intronic
1010892601 6:81333147-81333169 ACATGCAGCAGTGTATTTGCTGG - Intergenic
1016022499 6:139250716-139250738 TCTTGCAGCCCTGTAGTTGCAGG + Intronic
1018766774 6:166939810-166939832 ACGTGCAGCCCTTTAGTTATAGG - Intronic
1018802424 6:167234849-167234871 ACTTGCAGCCCTGAGTTTCAGGG + Intergenic
1018808363 6:167278647-167278669 ACTTGCAGCCCTGAGTTTCAGGG - Intronic
1027326280 7:77052508-77052530 CCGTGCAGCCCTGACCTTCCAGG + Intergenic
1029687156 7:102156810-102156832 ACGTGCAGCCCTGTGAATACAGG + Intronic
1030298696 7:107954228-107954250 CACTGCAGCCCTGAATTTCCGGG + Intronic
1032370352 7:131343772-131343794 AAGTGCTGCCCTGTATGCCCCGG - Intronic
1033572509 7:142645981-142646003 CTGTGCAGCCCTGTGTCTCCTGG + Intergenic
1038693276 8:29782483-29782505 AAGTGCAGCCCTGCATTTCCAGG + Intergenic
1038764012 8:30410858-30410880 ACGTGCAGTCCTGGCTTTCCAGG - Intronic
1049057994 8:140254243-140254265 AGGTGCAGCCCTGTGTATCCTGG + Intronic
1049802810 8:144526030-144526052 ACCTGCAGCCCTGTTTTCCCTGG - Exonic
1062377392 9:136268250-136268272 GCGTGAAGCCCTGTGTGTCCGGG - Intergenic
1190360708 X:49645564-49645586 ACTTGCAGCCCTGTGCCTCCCGG + Intergenic