ID: 907710477

View in Genome Browser
Species Human (GRCh38)
Location 1:56876105-56876127
Sequence CTGCCTTGATGGCTCTGATG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 1, 2: 3, 3: 21, 4: 216}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907710469_907710477 24 Left 907710469 1:56876058-56876080 CCAGGTCGCTGCCTGAAACGCCA 0: 1
1: 0
2: 0
3: 16
4: 71
Right 907710477 1:56876105-56876127 CTGCCTTGATGGCTCTGATGAGG 0: 1
1: 1
2: 3
3: 21
4: 216
907710473_907710477 1 Left 907710473 1:56876081-56876103 CCTTGTGTGTAATGGAGACCAGG 0: 1
1: 0
2: 0
3: 13
4: 160
Right 907710477 1:56876105-56876127 CTGCCTTGATGGCTCTGATGAGG 0: 1
1: 1
2: 3
3: 21
4: 216
907710470_907710477 13 Left 907710470 1:56876069-56876091 CCTGAAACGCCACCTTGTGTGTA 0: 1
1: 0
2: 0
3: 3
4: 58
Right 907710477 1:56876105-56876127 CTGCCTTGATGGCTCTGATGAGG 0: 1
1: 1
2: 3
3: 21
4: 216
907710472_907710477 4 Left 907710472 1:56876078-56876100 CCACCTTGTGTGTAATGGAGACC 0: 1
1: 0
2: 0
3: 6
4: 72
Right 907710477 1:56876105-56876127 CTGCCTTGATGGCTCTGATGAGG 0: 1
1: 1
2: 3
3: 21
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907710477 Original CRISPR CTGCCTTGATGGCTCTGATG AGG Exonic