ID: 907710477

View in Genome Browser
Species Human (GRCh38)
Location 1:56876105-56876127
Sequence CTGCCTTGATGGCTCTGATG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 1, 2: 3, 3: 21, 4: 216}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907710469_907710477 24 Left 907710469 1:56876058-56876080 CCAGGTCGCTGCCTGAAACGCCA 0: 1
1: 0
2: 0
3: 16
4: 71
Right 907710477 1:56876105-56876127 CTGCCTTGATGGCTCTGATGAGG 0: 1
1: 1
2: 3
3: 21
4: 216
907710473_907710477 1 Left 907710473 1:56876081-56876103 CCTTGTGTGTAATGGAGACCAGG 0: 1
1: 0
2: 0
3: 13
4: 160
Right 907710477 1:56876105-56876127 CTGCCTTGATGGCTCTGATGAGG 0: 1
1: 1
2: 3
3: 21
4: 216
907710472_907710477 4 Left 907710472 1:56876078-56876100 CCACCTTGTGTGTAATGGAGACC 0: 1
1: 0
2: 0
3: 6
4: 72
Right 907710477 1:56876105-56876127 CTGCCTTGATGGCTCTGATGAGG 0: 1
1: 1
2: 3
3: 21
4: 216
907710470_907710477 13 Left 907710470 1:56876069-56876091 CCTGAAACGCCACCTTGTGTGTA 0: 1
1: 0
2: 0
3: 3
4: 58
Right 907710477 1:56876105-56876127 CTGCCTTGATGGCTCTGATGAGG 0: 1
1: 1
2: 3
3: 21
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907710477 Original CRISPR CTGCCTTGATGGCTCTGATG AGG Exonic
900156029 1:1203602-1203624 CTCCCTTGCTGGCCCTGATGGGG - Exonic
901068804 1:6507240-6507262 CTTCCTTCATGGCACAGATGAGG + Intronic
901123531 1:6913429-6913451 TTACCATGATGGCTCTGCTGGGG - Intronic
903298120 1:22358880-22358902 CTGCTGTGATGGCCCTGGTGGGG + Intergenic
905128396 1:35732707-35732729 CTGCCACTATGGCTCTGAGGAGG - Intronic
907340768 1:53734638-53734660 CTGCCTTGGGGGCTCTTGTGAGG - Intergenic
907710477 1:56876105-56876127 CTGCCTTGATGGCTCTGATGAGG + Exonic
909691323 1:78410392-78410414 CTGGCTTGATAGCCCTGGTGTGG - Intronic
909987002 1:82173256-82173278 CATCCTTGATGGCACTGAAGTGG + Intergenic
914918533 1:151832581-151832603 CTGCAGTGAAGGCTCTGAAGGGG + Intergenic
915972886 1:160366738-160366760 CTGCCCTGCTGCCTCTGGTGTGG + Intergenic
916509947 1:165464361-165464383 CATCCTTGAGGGGTCTGATGTGG + Intergenic
916986211 1:170194052-170194074 CTTGCCTGATTGCTCTGATGAGG + Intergenic
917982517 1:180279693-180279715 GAGCCCTGATGACTCTGATGAGG - Intronic
920102037 1:203522784-203522806 CTACCTTGTTGGCTATTATGAGG - Intergenic
921761339 1:218918713-218918735 CTACCCAGTTGGCTCTGATGAGG - Intergenic
1062941067 10:1421875-1421897 GTTCCTTGATGGGTCTGCTGAGG + Intronic
1063967141 10:11354993-11355015 CTGCAATGATGGGGCTGATGTGG - Intergenic
1064594294 10:16927922-16927944 CTGCCTTCAGGTCTCTGGTGTGG - Intronic
1066547124 10:36511861-36511883 CTGCCGGGGTGGCTCTGGTGTGG - Intergenic
1066661351 10:37740511-37740533 CTGCCTAGAAGGCTCTGGGGTGG - Intergenic
1067690010 10:48495806-48495828 CTGGCTTGCTGGCTGTGTTGAGG + Intronic
1071732598 10:88263627-88263649 CTGCCTTAATTGCACTGATTGGG + Intergenic
1072121026 10:92405675-92405697 CTGCCTTGTAGGCTGTCATGAGG - Intergenic
1073314282 10:102567546-102567568 CTCCCTCGAGGGTTCTGATGAGG + Intronic
1076615091 10:131749778-131749800 CTGCTCTGATTGCTCTGATGAGG - Intergenic
1077523266 11:3048857-3048879 CTGCTTTGAAGGCTCTAAGGAGG - Intronic
1078101652 11:8333788-8333810 CTGCCCTGCTGGCTGAGATGTGG + Intergenic
1078856282 11:15208503-15208525 CTGTCTTGATGGCTGGGGTGGGG + Intronic
1079954292 11:26843295-26843317 CTGACTTGGGGTCTCTGATGAGG + Intergenic
1080294901 11:30715350-30715372 CTGCCTTGATTTCTTTCATGTGG - Intergenic
1080460307 11:32449128-32449150 CTGCCCAGATGGCTCTGGGGGGG + Intergenic
1081935219 11:46899396-46899418 CTGCAAAGATGGCTCCGATGAGG - Exonic
1083773815 11:64883428-64883450 CTGCCTTGCTGGGGCTGATGAGG + Intronic
1083886091 11:65574199-65574221 CTGCCTGGCTGGCTCTGGGGCGG + Intergenic
1087364743 11:97203928-97203950 CAGACTTGATGGGGCTGATGAGG + Intergenic
1089860240 11:121583546-121583568 CTGCCAGGATGGTTCCGATGAGG + Exonic
1092666768 12:10809376-10809398 CTGCCTTTATGGCCCTCATGTGG + Exonic
1093361758 12:18237827-18237849 CTGCCTTGAGGCCTAAGATGAGG - Intronic
1095313517 12:40729517-40729539 CTGCATTGATGGCTTGCATGAGG - Intronic
1096542174 12:52314068-52314090 CAGTCTGGATGGCTCTGAAGGGG - Intergenic
1096969900 12:55657363-55657385 CTGACTTCATGGCTCTGCTGTGG - Intergenic
1097175664 12:57141474-57141496 CTGCATGGACGGCTCAGATGAGG + Exonic
1100411218 12:94321803-94321825 CTGGCTGGATGGCCCTGGTGGGG + Intronic
1100790236 12:98122250-98122272 CTGCCTTGATGGAGAAGATGAGG - Intergenic
1103904780 12:124321665-124321687 CATCCTTGGGGGCTCTGATGGGG - Intergenic
1105546939 13:21357552-21357574 TTGCCTTGATGGCTCTCAAGCGG - Intergenic
1106248608 13:27967998-27968020 CTTCTTAGATGGCTCAGATGGGG + Intronic
1107189908 13:37568906-37568928 ATGCCTTGATTGCTCTTATGGGG + Intronic
1110099985 13:71586794-71586816 ATGATTTGATGGCTTTGATGAGG - Intronic
1112204452 13:97310134-97310156 CTGCCTTCAGGGTTCTGATTGGG + Intronic
1113167008 13:107453389-107453411 ATGCCTTGATGGCTTCCATGTGG - Intronic
1116263553 14:42660805-42660827 ATGCCTTGATGGCTTCCATGTGG + Intergenic
1117218705 14:53579429-53579451 TTGCTTTGATGGCTTTGAAGGGG + Intergenic
1118708619 14:68502048-68502070 CTCCTTTGATGGCTCAGACGTGG - Intronic
1118818004 14:69326184-69326206 GTGCCTTGATGGGGCTGATCTGG - Intronic
1121168088 14:91827450-91827472 CTGTCTTGTTGGCTTTGAAGTGG - Intronic
1121570772 14:94945093-94945115 CTGTCTTGATGGCCCTCCTGGGG + Intergenic
1121596466 14:95167240-95167262 AAGCCTTGATGGCTTCGATGTGG + Intergenic
1122538063 14:102480106-102480128 CTCCTCTGATGGCTCTAATGTGG - Intronic
1124210953 15:27764612-27764634 CTACCTTGGTGGCTCTGGGGTGG - Intronic
1124219175 15:27834577-27834599 CTGAATTGAGGGCACTGATGAGG + Intronic
1125486737 15:40116362-40116384 CAGCCAGGATGTCTCTGATGTGG + Intergenic
1125522053 15:40353758-40353780 CAGCCTGGATGGCTCCCATGTGG + Intronic
1127697732 15:61468366-61468388 CTGATTTGATTGTTCTGATGTGG - Intergenic
1128247658 15:66144015-66144037 CTGCCCTGAGCTCTCTGATGGGG - Intronic
1128887519 15:71302483-71302505 CTGCCTTGATGCATGAGATGTGG + Intronic
1129029002 15:72605166-72605188 TTGCCTGGATTGCGCTGATGTGG + Intergenic
1129068342 15:72929604-72929626 CTTGCTTGATTGCTCTGGTGAGG + Intergenic
1129276843 15:74451166-74451188 CTTCCCTGATTGCTGTGATGTGG + Intronic
1129616266 15:77100925-77100947 CTGAAATGAGGGCTCTGATGTGG + Exonic
1129766447 15:78172359-78172381 ATGCTTTGATGGTTGTGATGGGG + Intronic
1130870023 15:87963176-87963198 CTGCATTGCTACCTCTGATGAGG - Intronic
1132783576 16:1642035-1642057 CTGCCGGGATAGCTCTGGTGTGG - Intronic
1132999273 16:2840989-2841011 CGGCCTTGGTGGCTGTGAGGAGG - Intergenic
1133323247 16:4927785-4927807 CTGCCTCCAGGCCTCTGATGGGG + Intronic
1135759348 16:25124480-25124502 CTGCCTTGTAGGATCTTATGGGG + Intronic
1136009131 16:27351258-27351280 CTGCCTTGATGGCTTTGCAAAGG - Intronic
1138113890 16:54345162-54345184 CAGGTGTGATGGCTCTGATGGGG + Intergenic
1138127064 16:54447776-54447798 CTGCCTTGATGACTCTGCAGAGG + Intergenic
1138549636 16:57740429-57740451 CTGCCTGGGTGTCTCTGCTGCGG - Intronic
1138580502 16:57937865-57937887 CTGACTTAATGGCTGGGATGAGG + Intronic
1139648280 16:68347726-68347748 CTGGGTTGATGGCTTTGAAGTGG + Intronic
1139959953 16:70711693-70711715 CTGCCTTTCTGGCTGTGATTAGG + Intronic
1140945859 16:79767888-79767910 CTGTCTTGATTGCTCTAATTGGG + Intergenic
1146018025 17:29249217-29249239 CTGCCCTGTTGGATGTGATGGGG - Intronic
1148442169 17:47717036-47717058 CTGCGTTGAGGGATCTGAGGTGG + Intergenic
1148606503 17:48933318-48933340 GTTTCTTGATGGCTCTGATCAGG + Exonic
1148682010 17:49479549-49479571 CTGCCTCCACGGCTCTGAGGAGG + Intergenic
1149335745 17:55633935-55633957 CTGCATTAATGGCTTTCATGAGG + Intergenic
1150295254 17:64003951-64003973 CTGCCTTGGAGGCTCTGCAGGGG + Exonic
1151334962 17:73434349-73434371 CTTCCTTGAGGGCTGGGATGGGG - Intronic
1155591319 18:27429936-27429958 CTGCCTTGATGTCTGTGATCTGG - Intergenic
1155733344 18:29189846-29189868 CAGCCTTGATGGTGGTGATGGGG + Intergenic
1157156588 18:45273312-45273334 CTGCCTTGTTGGCTCTGATTGGG + Intronic
1158537616 18:58322592-58322614 CTGCCTTGCTTGCTGTGGTGTGG + Intronic
1160678884 19:404364-404386 CTGCCCTGAGGGGTCTGAGGGGG + Intergenic
1160678992 19:404587-404609 CTGCCCTGAGGGGTCTGAGGGGG + Intergenic
1160679019 19:404652-404674 CTGCCCTGAGGGGTCTGAGGGGG + Intergenic
1160738376 19:674915-674937 CTGCCTTAGTGGCACTGAGGGGG - Intergenic
1161068474 19:2249373-2249395 CTGCCCTGGGGGCTCTGCTGGGG + Exonic
1161563406 19:4986136-4986158 CTGCCGTGGGGGCTGTGATGGGG + Intronic
1162336257 19:10062262-10062284 CTGTCTTGGGGGCTCTGATCTGG - Intergenic
1163911949 19:20203497-20203519 CTGCCTAGATGGCTGTGAATGGG - Intergenic
926213158 2:10886422-10886444 CTGCCTTGGTGTCTCTTATAAGG + Intergenic
928992442 2:37248249-37248271 CCACCTTGAAGTCTCTGATGAGG - Exonic
929438290 2:41945693-41945715 CTGCCTTGAGGTTTCTCATGAGG - Intronic
930006126 2:46898584-46898606 CTGGCTCCATGGCTCTGCTGAGG - Intergenic
932732670 2:74232102-74232124 CTGCCCTGATGGCCCTCCTGCGG - Intronic
933885006 2:86711268-86711290 CCACCTTGATGCCTCTGATTGGG + Intronic
933925168 2:87085416-87085438 CCACCTTGATGCCTCTGATTGGG - Intergenic
935571956 2:104671205-104671227 CTGCCTGGACAGCTCTGCTGGGG - Intergenic
937147951 2:119663464-119663486 CTGCCTGGCTTGCTCTGATGGGG - Intergenic
939303451 2:140378179-140378201 CTGTGCAGATGGCTCTGATGAGG - Exonic
941761007 2:169243412-169243434 TTGTGTTGATGGATCTGATGAGG - Exonic
942062615 2:172241525-172241547 CTGCCTTGATTGCAGGGATGTGG + Intergenic
943611905 2:190044587-190044609 CTGGCTCGATAGCTCTGGTGGGG + Intronic
943923102 2:193736280-193736302 GTGCCATGATGGCTTTGAAGGGG - Intergenic
944122826 2:196259329-196259351 CTGACTTGAAGGCACTGAGGTGG + Intronic
944419360 2:199512617-199512639 TTGTCTTGAAGACTCTGATGGGG - Intergenic
946182538 2:217957200-217957222 CTGCCTGGCTGGCTCGGAAGGGG - Intronic
947309332 2:228783282-228783304 CTTCCTTGAGTGCTCTGAAGAGG - Intergenic
947775140 2:232702651-232702673 CTGCCTTTAATGCTCTGTTGGGG - Intronic
1168759772 20:342069-342091 CTGCCTTGGTGTCTCTTTTGTGG - Intergenic
1168962425 20:1878329-1878351 CTCCCTTGATGGCGATGAGGAGG + Intergenic
1171282071 20:23909663-23909685 CTGGCTTAATAGCTCTGGTGGGG + Intergenic
1172192838 20:33072233-33072255 CTCTCTTTATGGTTCTGATGGGG + Intronic
1174772194 20:53310750-53310772 CTCCCTTGCTGGCTTTGATGAGG - Intronic
1174826517 20:53773460-53773482 CAGTCTTGCTGGCTCTGATTCGG + Intergenic
1175013609 20:55764824-55764846 AAGCCTTGATGGCTTTCATGTGG - Intergenic
1178639620 21:34335551-34335573 CTCCCCTGATGGCCCTAATGAGG - Intergenic
1178671553 21:34595762-34595784 CTGCCTGGATGGCTCTGATGGGG + Intronic
1179168460 21:38953889-38953911 CTCCTTTGATGACTCTGATGAGG - Intergenic
1179288551 21:39998426-39998448 CTGACTTGATGACTCTGCTTTGG + Intergenic
1179377443 21:40863273-40863295 CTGCCTTGGTGGCTTCAATGGGG - Intergenic
1183477847 22:38045902-38045924 CTGGCTTGCTGGCTCGGCTGGGG + Intergenic
1183829561 22:40410563-40410585 CTGCCCTCATGGCACTGATAAGG + Exonic
1183975029 22:41507053-41507075 CTGCCATTTTGGCTCTGATGAGG + Intronic
1184920955 22:47605624-47605646 GTGACAGGATGGCTCTGATGTGG - Intergenic
1185044463 22:48522299-48522321 CTGCCTTGGGGGCTCTGAACAGG + Intronic
950107143 3:10395406-10395428 CTGAATTGATGGCTGTGTTGTGG + Intronic
950923228 3:16716056-16716078 CTGGCTTGATAGCTCTGATAGGG + Intergenic
953676695 3:45008096-45008118 GCGCCTTGATGGCTCTGCTAGGG - Intronic
954826652 3:53379330-53379352 CTGCCTTGATGTCTCTGATTTGG + Intergenic
955791122 3:62589709-62589731 CTGGCTTGATCGCTCTGGAGAGG + Intronic
955990651 3:64623492-64623514 CTGGCTTGAAGTCTCTCATGAGG - Intronic
956844117 3:73166648-73166670 CTGCCTCGGTGTCTCTCATGAGG + Intergenic
957708135 3:83816608-83816630 CTTCATTGATGGTACTGATGAGG + Intergenic
959614227 3:108329405-108329427 CTACTTTGATGCCTCTGATTAGG - Intronic
961135083 3:124502607-124502629 CTGCCTTCATTGCACAGATGAGG - Intronic
963048757 3:141124469-141124491 CTGCCTAGGAGGGTCTGATGAGG + Intronic
963417726 3:145019375-145019397 CTGACTTTATGGGTCTTATGGGG + Intergenic
967233530 3:187363838-187363860 CTGCCTAGAAAGCTGTGATGAGG + Intergenic
967349728 3:188500105-188500127 CTTCCCTGATTACTCTGATGAGG + Intronic
967442339 3:189523335-189523357 CTTCCCTGATTGCTCTGAAGAGG - Intergenic
967490352 3:190083601-190083623 CTGCCTTTATGCCTGTGATGGGG - Intronic
967875889 3:194268250-194268272 CTGCCTTGATGGAGGTGACGTGG - Intergenic
967875899 3:194268289-194268311 CTGCCTTGATGGAGGTGATGCGG - Intergenic
967875909 3:194268328-194268350 CTGCCTTGATGGAGGTGACGCGG - Intergenic
967875919 3:194268367-194268389 CTGCCTTGATGGAGGTGACGCGG - Intergenic
969532469 4:7737438-7737460 CTGCCTTGATGGGGCTGTCGGGG - Intronic
971097975 4:23429604-23429626 CTCTTTTGATGGCTTTGATGGGG - Intergenic
971223814 4:24733163-24733185 CTGCCTCAAGGGATCTGATGAGG - Intergenic
972609836 4:40646264-40646286 CTTCCTGGATGGGGCTGATGCGG + Intergenic
972706966 4:41554297-41554319 CTGAATTGGTGGCTCTGCTGAGG + Intronic
975077557 4:70231212-70231234 CTGCCAAGATGGCTGTGATCAGG - Exonic
976273203 4:83250474-83250496 CTGCCTGCATGGCTCTGGTTAGG + Intergenic
977030459 4:91876334-91876356 AAGCCTTGATGGCTTTCATGTGG + Intergenic
977039834 4:92002228-92002250 CTGCCCTGCTGGCTCTAAAGAGG + Intergenic
979970833 4:127132807-127132829 CTTCCTTCATGGCTGTGATCTGG - Intergenic
982223352 4:153143278-153143300 CTGGCTTGTTGCCTCTGATTTGG + Intergenic
984289233 4:177772125-177772147 CTGCATTTATGCCTCTAATGTGG + Intronic
985535080 5:460091-460113 CTGACTTGATGGCACTGCAGTGG - Intronic
985873576 5:2577941-2577963 TGGCCTGGATGGCTCTCATGTGG + Intergenic
987431937 5:17845265-17845287 CTGGCTTGATAGCTCTGGTGAGG + Intergenic
989567538 5:42916000-42916022 CAGCCTTGATGTCTGTGTTGTGG + Intergenic
989667399 5:43872160-43872182 CTGCCTAAATGGCTTTGATTTGG - Intergenic
989693292 5:44170656-44170678 CTGGCTTGATAGCTCTGGTCAGG - Intergenic
991420897 5:66440508-66440530 CTGCCTCGCTGACTCTTATGAGG - Intergenic
994418790 5:99507041-99507063 CTGACTTGATGCCTTTGATTTGG + Intergenic
994583198 5:101674138-101674160 TTGCAGTGATAGCTCTGATGGGG - Intergenic
996760544 5:126982357-126982379 CTGTCTTGATGGCAGGGATGGGG + Intronic
1000981157 5:167818619-167818641 CTGCCCTGAGTGCTGTGATGTGG - Intronic
1002067012 5:176656921-176656943 CTGCCTTGATGTCACTCACGAGG - Exonic
1002894189 6:1366295-1366317 CTGCCTTCATGGGTCTGCTCTGG + Intergenic
1004078995 6:12372290-12372312 GTGACTTGAAGCCTCTGATGGGG - Intergenic
1005105708 6:22222522-22222544 CTCTCTTGATGGTTCTGCTGGGG + Intergenic
1005124666 6:22433163-22433185 CTGCTTCTATGGCTCTGATCTGG + Intergenic
1005684886 6:28244779-28244801 CTGGTTGGATGGCTCTGATGTGG - Exonic
1007079258 6:39087096-39087118 CTGCCTCCATGGTGCTGATGGGG - Exonic
1014124377 6:117759834-117759856 CTGGCTTGATAGCTCTGGTGGGG - Intergenic
1014827326 6:126061203-126061225 CTGCTTTGGTAGGTCTGATGTGG - Intergenic
1015600091 6:134903284-134903306 CTGCCTTGAGTGCCCTGGTGTGG - Intergenic
1016061768 6:139637837-139637859 CTCCATTGCTGGCTCTGAAGAGG - Intergenic
1017812205 6:157991354-157991376 CTGCCTCGTTGGCTCTGGGGTGG + Intronic
1021175841 7:17449215-17449237 CGGGCTTGATAGCTCTGGTGGGG + Intergenic
1021395215 7:20139172-20139194 CAGCCTTAATGGCCCTAATGTGG + Exonic
1022802308 7:33788198-33788220 CAGCCTTCATGGCTCTAATTGGG - Intergenic
1024165266 7:46723891-46723913 CTGGCTTGATAGCCCTGGTGGGG - Intronic
1024259894 7:47566231-47566253 CTGCTTGGGTGGCTCTGTTGAGG - Intronic
1029807062 7:103009319-103009341 CTGCCTTGATGGATTGAATGTGG - Intronic
1032323103 7:130901991-130902013 CTGCCCTGATGGCAGGGATGTGG - Intergenic
1032475016 7:132205650-132205672 CTGCCTGGATGGCTCTGAGCAGG + Intronic
1032630684 7:133647806-133647828 CTTCCATGATGGCTCTAATTAGG - Intronic
1034267623 7:149788896-149788918 CTGTGGCGATGGCTCTGATGAGG + Intergenic
1034269475 7:149796690-149796712 CTGCGAGGATGGCTCGGATGAGG + Intergenic
1034270600 7:149801924-149801946 CTGCCAGGATGGCTCGGACGAGG + Intergenic
1034836994 7:154361930-154361952 CTGCCATGATGGCTCACATCTGG + Intronic
1036101438 8:5790858-5790880 ATCCCTTGATGGCTTTGATAAGG + Intergenic
1037566206 8:20120492-20120514 CTGCAATGCTGCCTCTGATGTGG - Intergenic
1037887730 8:22603807-22603829 CTGCCAGCATGGCTCTGAGGAGG - Exonic
1038859536 8:31372153-31372175 CTTGCCTGATTGCTCTGATGAGG + Intergenic
1038883227 8:31637739-31637761 CCTCATTGATGGCTCTGCTGGGG - Intergenic
1038910102 8:31953905-31953927 CTGGCTTGTTAGCTCTGATTTGG + Intronic
1039174617 8:34789622-34789644 CTGCCTTGAAGGCTATGGTAGGG + Intergenic
1045699456 8:104849813-104849835 CTGTCTTGATAGCCCTGGTGTGG + Intronic
1047279540 8:123433181-123433203 TTGCCTTCATGGCACAGATGAGG - Intronic
1047694575 8:127390792-127390814 CTAGCATGATGGCTGTGATGTGG - Intergenic
1048973442 8:139657867-139657889 CTGCCTGGATGGGGGTGATGTGG - Intronic
1049299138 8:141860618-141860640 CAGCCCTGATGGCTCTGCTCAGG - Intergenic
1051148953 9:14060043-14060065 CTGGATTGAGGGCTCTGGTGAGG + Intergenic
1052378208 9:27741622-27741644 CTGGCTTGATAGCTCTGGTAGGG + Intergenic
1056102607 9:83314171-83314193 TGGCCTTGATGGCTCTGTTTAGG - Intronic
1060693143 9:125682908-125682930 CTGCCTTCATGGATCTTCTGAGG + Intronic
1060784449 9:126439163-126439185 CTGCGTTGATGCCTCTGAGCAGG + Intronic
1061211050 9:129193695-129193717 TCGCCTTCATGGCTCTGCTGTGG + Intergenic
1186804204 X:13123411-13123433 CTGCCTTCTTTGATCTGATGTGG + Intergenic
1188308549 X:28588138-28588160 TCGCATTGATGGCTGTGATGTGG + Intronic
1189353530 X:40294892-40294914 CTGCCTTGATGGTGCTGCTTGGG + Intergenic
1191932305 X:66387594-66387616 CTGCCTTGAGAGCTCTGTTCAGG + Intergenic
1192186960 X:68953598-68953620 CTCCCTAGATGGCTCCAATGTGG - Intergenic
1195148698 X:102043869-102043891 CTGGCTTAATAGCTCTGGTGGGG - Intergenic
1195364710 X:104114921-104114943 TACCCTTGATGACTCTGATGAGG + Exonic
1196593752 X:117519508-117519530 TTGCCTTGAGGGCTGAGATGAGG - Intergenic
1196603220 X:117625443-117625465 CTGCTTTGATGGATTTGATACGG - Intergenic
1197020434 X:121681174-121681196 CTCCCTTGCTGGCTCTGATGAGG + Intergenic
1198083488 X:133261719-133261741 CTGCCCTGCTGGCTTTGAAGGGG + Intergenic
1199249025 X:145638144-145638166 CTGGCTTGATAGCTCTGGTGTGG - Intergenic
1199934096 X:152554095-152554117 CTGCATTGATGGCTAGGAGGTGG - Intergenic
1200064717 X:153498811-153498833 CTGCCCTGCTGGCTGTGTTGGGG + Intronic
1200072094 X:153534256-153534278 CTGCCTTGAGGGGTCAGAAGTGG + Intronic
1200743234 Y:6877734-6877756 CTGCATTGATGGCTATGAACAGG + Intergenic