ID: 907711064

View in Genome Browser
Species Human (GRCh38)
Location 1:56881911-56881933
Sequence CAGAGCCACAACTTAGAAAT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 215}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907711064_907711066 26 Left 907711064 1:56881911-56881933 CCTATTTCTAAGTTGTGGCTCTG 0: 1
1: 0
2: 1
3: 11
4: 215
Right 907711066 1:56881960-56881982 GCTAACTCACTGCCCTCCTTGGG No data
907711064_907711065 25 Left 907711064 1:56881911-56881933 CCTATTTCTAAGTTGTGGCTCTG 0: 1
1: 0
2: 1
3: 11
4: 215
Right 907711065 1:56881959-56881981 AGCTAACTCACTGCCCTCCTTGG 0: 1
1: 0
2: 2
3: 16
4: 223

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907711064 Original CRISPR CAGAGCCACAACTTAGAAAT AGG (reversed) Intronic
904238361 1:29128267-29128289 CACAGCCTCAACTAAGAATTTGG + Intergenic
906106434 1:43296184-43296206 CAAAGGCAGAACTTAGGAATTGG + Intergenic
907711064 1:56881911-56881933 CAGAGCCACAACTTAGAAATAGG - Intronic
910003642 1:82367517-82367539 AAGAGACACAACTGAAAAATTGG - Intergenic
910286393 1:85559244-85559266 CAGAGTCACATCTTAGTAGTAGG + Intronic
910520194 1:88112314-88112336 AAGAGCCCCAACTTTGAAAGAGG - Intergenic
912616514 1:111106000-111106022 CAAAGCCAAAATTTAAAAATGGG - Intergenic
914397181 1:147281107-147281129 GAGAGAGACAACTTAGAAGTGGG - Intronic
915634270 1:157175392-157175414 CAGAGCCACAATGCAGAATTGGG + Intergenic
916861354 1:168809198-168809220 CAGAGCCAACACTTAAAATTGGG - Intergenic
921959097 1:221015456-221015478 CTGAGAGAGAACTTAGAAATCGG + Intergenic
924393263 1:243587122-243587144 CAGAGACAAAACTTAAAAAAGGG + Intronic
1063628534 10:7713409-7713431 CAGAGCCAGATGTTAGAATTAGG + Intronic
1064738253 10:18406117-18406139 CGGAGCCACAAAGAAGAAATTGG + Intronic
1064949249 10:20829143-20829165 CAGAGCCTCAACTTAAAACCAGG + Intronic
1068148716 10:53104677-53104699 AAGAGCCCCCACTTCGAAATGGG - Intergenic
1068359645 10:55960417-55960439 CCATGCCACAACTAAGAAATAGG - Intergenic
1068571772 10:58637815-58637837 CAGTGGCATAACTTATAAATTGG + Intronic
1069772347 10:70907803-70907825 CAAAGCCAAAAGTTAAAAATAGG - Intergenic
1071391541 10:85180220-85180242 CAAAGCCCCAACTTCAAAATTGG - Intergenic
1075507462 10:123037090-123037112 GATTGCCACAACTTAGAAGTAGG + Intronic
1076119269 10:127922710-127922732 CCCAGCCACAACATAGAAAGGGG + Intronic
1076121767 10:127941901-127941923 CAGAGCCACCAGTGAGAAGTTGG + Intronic
1076327272 10:129635275-129635297 CAGAGACACATCTCAGAAAGAGG - Intronic
1076821244 10:132940925-132940947 CAGAGCCAGAACTTATCAAGTGG - Intronic
1078191711 11:9096539-9096561 CAGAGCCTGAAGTTAGAGATGGG - Intronic
1078638223 11:13072464-13072486 CAGAGCGAAAACATACAAATGGG - Intergenic
1078972981 11:16436571-16436593 CAGAGCCAGGACTTAAAATTAGG - Intronic
1079285923 11:19132327-19132349 GAGGGCCACACCTTAGAAGTAGG - Intronic
1079685715 11:23357058-23357080 CAGAGCCAGAACTTCAAAAAAGG - Intergenic
1080298983 11:30762914-30762936 CAGAGCCAAAAATTAGAGTTTGG - Intergenic
1080838678 11:35964448-35964470 CAGAGACCCAGCTTAGAACTTGG + Intronic
1080894018 11:36434093-36434115 CAGAGTGAAAACTCAGAAATGGG + Intronic
1081945865 11:46993248-46993270 AAAAGCCAAAACTGAGAAATGGG - Intronic
1082272011 11:50182709-50182731 CTGAGTCACAACTCAGAAATAGG - Intergenic
1087435953 11:98117828-98117850 CAAAGCCAAAACTGACAAATGGG - Intergenic
1088854210 11:113732253-113732275 CCGAGCCAGAACTAAGAAAAAGG + Intergenic
1089693095 11:120198833-120198855 CAGAGCCACAATTCAGACTTGGG + Intergenic
1090164679 11:124534604-124534626 CAAAGGCACAAGTGAGAAATTGG + Intergenic
1092862259 12:12728732-12728754 CAGAGTCACAACTAACATATTGG - Intronic
1097117832 12:56711189-56711211 AAGGGCTACAATTTAGAAATGGG - Intergenic
1100878395 12:98988930-98988952 CAAAGCCCCAATTTAAAAATAGG - Intronic
1102726296 12:115068183-115068205 CACAGCCACAACTAAGAACAAGG - Intergenic
1106388067 13:29307490-29307512 CAGATCCACAACTGACAAGTTGG - Intronic
1109587652 13:64428766-64428788 AAGAACCACAACATAGAAACTGG + Intergenic
1110666255 13:78120537-78120559 CAGAGCCAAACCATAGCAATAGG + Intergenic
1110770458 13:79337533-79337555 GAGAGCAAGAACTTAGAAAAAGG - Intronic
1111103592 13:83616582-83616604 CAGATTTACAATTTAGAAATAGG + Intergenic
1113484468 13:110644207-110644229 CAGAGCCAATACTTATTAATTGG - Intronic
1113741072 13:112712681-112712703 TAGAGCCACACCTTGGAAACAGG - Intronic
1114824516 14:26060671-26060693 CAGAGCCACCAGTTGGAAATAGG + Intergenic
1115864032 14:37722860-37722882 CACAGCCACACCTAAGAAGTGGG + Intronic
1116630334 14:47323034-47323056 CAGAGCCACAAATTCCAAAGTGG + Intronic
1121550922 14:94799652-94799674 CACAGCCAGAATTTAGAATTGGG + Intergenic
1124454596 15:29829051-29829073 AAGAGCCAAGACTTAGAATTGGG - Intronic
1126154865 15:45556410-45556432 AAGATCCACAACCTAGAAACAGG - Intergenic
1127452100 15:59126554-59126576 CAAAGCCACAATTGACAAATGGG - Intergenic
1131309808 15:91279651-91279673 CAGAGCCATAAATCATAAATGGG - Intronic
1134647373 16:15880666-15880688 CCGAGCCACAGATTAGAAACTGG + Intronic
1135550863 16:23397252-23397274 CAGAGTCACAACTTACACATAGG + Intronic
1135676238 16:24417376-24417398 CAGAGACACAACTTAGGGAGAGG + Intergenic
1135923367 16:26670996-26671018 CAGAACCAAAACGTAAAAATTGG - Intergenic
1137757129 16:50911670-50911692 CACAGCCATAACTAGGAAATTGG + Intergenic
1138567146 16:57841830-57841852 CAGAGCCAAGACCTTGAAATGGG - Intronic
1139193518 16:64892084-64892106 CAGATTCACAGCTCAGAAATGGG + Intergenic
1139741329 16:69037520-69037542 CAGAGAAACAAGTTAGAGATAGG - Intronic
1140560469 16:75974533-75974555 AAGAGCCCCAACAGAGAAATAGG - Intergenic
1143573576 17:7776581-7776603 CAGAGCCACAGCTCAGAAAGGGG - Intronic
1143757090 17:9075120-9075142 CAGGCCCACCACTTAGAGATGGG + Intronic
1148827112 17:50401916-50401938 CAGAATCACAACATAGAGATTGG - Intergenic
1149099422 17:52885797-52885819 CAGATACACAACTTAGATATTGG - Intronic
1150713546 17:67551775-67551797 GAGAGCAGCAACTTAGAGATAGG - Intronic
1153107515 18:1544470-1544492 GAGAGCTACAAGTGAGAAATTGG + Intergenic
1158137008 18:54219130-54219152 CACAGACACAAGTGAGAAATCGG - Intronic
1159158697 18:64616452-64616474 CTGAGCCACAACCTAGAATGTGG - Intergenic
1159687406 18:71439630-71439652 CAGACTCAGAACTAAGAAATTGG - Intergenic
1159791066 18:72779549-72779571 CAGTGCTACTACTTGGAAATGGG - Intronic
1161990002 19:7679136-7679158 CAAAGCCACAACTTGGAAGATGG + Exonic
1162927867 19:13939056-13939078 CAGACCCACAACTTACCAACAGG + Intronic
1163930238 19:20383119-20383141 CAGAGCCACTTCTTTTAAATGGG + Intergenic
1164571570 19:29378487-29378509 CAAAGCAACAGCTAAGAAATGGG - Intergenic
925548171 2:5041045-5041067 CAGAGCCACTTCTAAGAAAAGGG - Intergenic
926260046 2:11251643-11251665 CAAAGCCAAAACTGACAAATAGG + Intronic
927447451 2:23176649-23176671 CAAAGCCAAAACTGACAAATGGG + Intergenic
927455559 2:23246281-23246303 AATAGGCACAACTTAGAATTGGG - Intergenic
930649626 2:53951713-53951735 CAAATCCAAAAATTAGAAATTGG - Intronic
936929455 2:117772565-117772587 CATAGCCACAAATGACAAATGGG + Intergenic
939212564 2:139195571-139195593 AAGAGCAAGAAGTTAGAAATAGG - Intergenic
939883896 2:147660186-147660208 CACAGCCACAAGTAAGAAAGAGG + Intergenic
940469873 2:154082922-154082944 AAAAGCCACAACTGACAAATGGG - Intronic
941348102 2:164395404-164395426 CAGAGCAACATCATAGAAGTGGG - Intergenic
942258964 2:174138293-174138315 CTGAGACACAACATTGAAATTGG - Intronic
943720636 2:191200030-191200052 CAGAGCCAGCACCTGGAAATGGG + Intergenic
945014055 2:205496289-205496311 AAGAGCTACAAATCAGAAATTGG + Intronic
947523986 2:230867450-230867472 CAGAGCTACAGCTGAGAAATGGG - Intronic
1169554483 20:6735070-6735092 CAGAGCCACAACAGGGAAAGAGG + Intergenic
1169593148 20:7167176-7167198 CAGAAACACTACATAGAAATTGG - Intergenic
1171809741 20:29735982-29736004 CAAAGCCACAATTGACAAATGGG + Intergenic
1171909093 20:30924971-30924993 CAAAGCCACAATTGACAAATGGG - Intergenic
1173089346 20:39955441-39955463 CAGAGCCACAACTCAAAAGAGGG - Intergenic
1173220533 20:41129098-41129120 AAAAGCCACAACTGACAAATGGG - Intergenic
1177382195 21:20359320-20359342 AAGAGCCACATTTTACAAATGGG - Intergenic
1178846361 21:36177119-36177141 CTTTGCCACACCTTAGAAATGGG - Intronic
1180295737 22:10932970-10932992 CAGAGACACAACTAAAAAAGAGG - Intergenic
949590303 3:5487383-5487405 AAGAGGCACAAATTAAAAATCGG - Intergenic
950138896 3:10601767-10601789 GAGACCCACACCTTAGAACTTGG + Intronic
950224794 3:11224803-11224825 CAGAGCCTCATCTGAAAAATGGG + Intronic
950444505 3:13028543-13028565 CAGAGCCAGACCCTAGAACTGGG + Intronic
950731960 3:14968118-14968140 CAAAGCCAAAATTGAGAAATGGG + Intronic
951804655 3:26631115-26631137 CAGGGCCACAACCAAGATATGGG + Intronic
958955909 3:100465938-100465960 CAAAGACACCACTTAAAAATGGG - Intergenic
960846833 3:122011746-122011768 CACAGCAACAACTGAGATATGGG - Intronic
961595891 3:128015915-128015937 CATACACACAACTTAAAAATTGG + Intergenic
963192821 3:142492188-142492210 AAGGGCCACACCTTAGAAGTAGG - Intronic
963579690 3:147109663-147109685 CAAAGCCAAAACTGACAAATGGG + Intergenic
964051783 3:152402622-152402644 CAGAGCCACAAATTTGTACTTGG + Intronic
965151874 3:164987999-164988021 CAGAGATAGAACTTAGAACTTGG - Intronic
965380413 3:167981309-167981331 GAGAGCCACAACTTAAAACTAGG - Intergenic
965587618 3:170332906-170332928 AAGAGCCACAATTGACAAATGGG - Intergenic
967294255 3:187949758-187949780 CAGAGTCACAACCTGGAATTGGG - Intergenic
969726131 4:8919546-8919568 CAGGGCTTCAACATAGAAATGGG - Intergenic
969830154 4:9789404-9789426 CAGAACCACTACATAGAAACAGG - Intronic
972245374 4:37241570-37241592 CAGATCAACAACCTAGAAGTTGG + Intergenic
975735027 4:77372685-77372707 CAGAGCTACAACTCACAAGTGGG - Intronic
975810468 4:78163496-78163518 GAGATCCACAACTTAGGAACTGG + Intronic
976118832 4:81758044-81758066 GAGAGCCACATCTTAGAGCTAGG + Intronic
976447328 4:85146249-85146271 CAGAGCCACAAGATGGAAAGAGG - Intergenic
977438811 4:97036839-97036861 AAAAGCCAAAACTTACAAATGGG - Intergenic
977971187 4:103216167-103216189 CAGAACTACAAGTAAGAAATGGG + Intergenic
978179070 4:105771380-105771402 CAAAGCCAAAACTGACAAATGGG - Intronic
978244727 4:106559101-106559123 CAGAGCCAAAATTGACAAATGGG - Intergenic
978606411 4:110484970-110484992 CTGAGTCACACCTCAGAAATAGG - Intronic
978859691 4:113433441-113433463 CAGAGCCACAATTTAAAAGAAGG + Intergenic
980387210 4:132101751-132101773 CAGACACAGAACTTAGAAACTGG + Intergenic
981287703 4:143039148-143039170 AAAAGCCATAACTTAGGAATAGG + Intergenic
981650002 4:147046660-147046682 CAAAGCCACATCTTATAAAGGGG - Intergenic
983084903 4:163430843-163430865 CAGAGCCACAAACTACAGATAGG - Intergenic
983799454 4:171908125-171908147 CAAAGCCAAAACTGACAAATGGG + Intronic
986417747 5:7545583-7545605 CAAAGTCACAGCTTAGAAAAGGG + Intronic
987231305 5:15896500-15896522 CAGAGCCACAATATACAGATTGG - Intronic
987722385 5:21654751-21654773 CATAGCAACAAAGTAGAAATGGG - Intergenic
988333784 5:29877934-29877956 CAAAGCCAAAACTGACAAATGGG - Intergenic
989192698 5:38686717-38686739 CAGAGCCTCAACCTAGAAGACGG - Intergenic
989524247 5:42434836-42434858 CATAGCCAAAGCTTACAAATTGG + Intronic
989850144 5:46198411-46198433 CAGAGCCAAAATTGACAAATGGG + Intergenic
990143893 5:52736655-52736677 CAAAGCCAAAACTGACAAATGGG + Intergenic
990149893 5:52804899-52804921 TAGAGCCAGAACTTAGATATGGG + Intronic
990683620 5:58274628-58274650 CAGAATCACTACCTAGAAATAGG + Intergenic
991532200 5:67627967-67627989 CAAAGCCACAATTGACAAATGGG - Intergenic
993129810 5:83881212-83881234 CAGAGCCACACCTTAGTGGTGGG + Intergenic
993860364 5:93128977-93128999 CAAAGCAAGAAATTAGAAATGGG + Intergenic
994528066 5:100931098-100931120 CAAAGCCAAAATTGAGAAATGGG - Intergenic
994683493 5:102920044-102920066 CAGATCCAGAACTGTGAAATCGG + Intronic
995431994 5:112089606-112089628 AAAAGCCAAAACTGAGAAATGGG - Intergenic
996539916 5:124619600-124619622 CAGAACTAAAACTTAGAAATAGG + Intergenic
997104716 5:131005752-131005774 AAGAGTCACAGCTTAGAATTGGG - Intergenic
999539971 5:152560656-152560678 AAGAGCAACAGCTTGGAAATGGG - Intergenic
999961981 5:156765719-156765741 CAAAGCCACTACCTAGAAAATGG + Intronic
1000480230 5:161764292-161764314 CAGAGCCACGAATTATAGATAGG - Intergenic
1000639163 5:163680490-163680512 CAAACCCAGAACTGAGAAATAGG - Intergenic
1003939709 6:11012089-11012111 CAGAGTCACAAATAAGGAATAGG - Intronic
1005004558 6:21274705-21274727 CAGAGCATCAGTTTAGAAATTGG - Intergenic
1006030627 6:31174349-31174371 CAGAGCCAGGACTTAGAACCTGG - Intronic
1007187424 6:39984184-39984206 CAGAGCTAGAACTGAGGAATAGG - Intergenic
1007531257 6:42544711-42544733 CAGAGCCAGGACTTATAAAGAGG + Intergenic
1009638220 6:66295120-66295142 CAGAGACACAAGTGAGAAAGAGG - Intergenic
1013019324 6:106196833-106196855 CACACCCACAAACTAGAAATTGG + Intronic
1013854486 6:114555400-114555422 CAAAGCCAAAATTGAGAAATGGG + Intergenic
1014331638 6:120074446-120074468 CAGAGTCAAAACTATGAAATAGG + Intergenic
1015466581 6:133555001-133555023 AAAAGCCAAAATTTAGAAATGGG - Intergenic
1015677480 6:135766473-135766495 AAGAGCCAAAACTGACAAATGGG - Intergenic
1016136866 6:140554857-140554879 CAGAGCCAAAGCTTGGAATTGGG + Intergenic
1016754659 6:147671060-147671082 CTGAGACACAACATTGAAATTGG - Intronic
1017338066 6:153285058-153285080 CAAAGCCACAATTGACAAATGGG - Intergenic
1017399016 6:154038738-154038760 CAGAGCTTCACCCTAGAAATTGG + Intronic
1017463711 6:154675030-154675052 CAAAGCAAAAACTTAGTAATTGG + Intergenic
1018286909 6:162250216-162250238 AATAGCCACAACTTAGAAATGGG + Intronic
1018738802 6:166711530-166711552 CAGAGCCTCAGCTAAGGAATGGG + Intronic
1018789305 6:167134459-167134481 TGGAGTCACAACTTAGAGATCGG - Intronic
1021060259 7:16102437-16102459 CAGAGCCAAAATTGACAAATGGG + Intronic
1023463764 7:40430600-40430622 CAGACCAGCAACTTAGAGATTGG - Intronic
1027784824 7:82567587-82567609 CAGAAGCAGAAGTTAGAAATGGG - Intergenic
1028302481 7:89217889-89217911 CACAATCACAACCTAGAAATGGG + Intronic
1031403770 7:121357826-121357848 TATAGCCACAACTAAGAACTAGG - Intronic
1032942464 7:136810671-136810693 AAGAGCCACGGCTTAGAATTGGG - Intergenic
1033816149 7:145075935-145075957 CAGAGCCAAACCATAGCAATTGG - Intergenic
1034520038 7:151612702-151612724 CTGAGCATCATCTTAGAAATGGG - Intronic
1037634484 8:20689125-20689147 CTGATCCACAACTTAGTGATGGG + Intergenic
1038391665 8:27207553-27207575 CAGAACCACAGCTGATAAATGGG + Intergenic
1039345700 8:36702624-36702646 GAGACCCACAGCTTTGAAATGGG + Intergenic
1041539441 8:58966561-58966583 TAGACCCACAACTTAGAAGCTGG + Intronic
1042692716 8:71520350-71520372 CAGAGCCAAAACTAACAAACAGG + Intronic
1042711599 8:71723390-71723412 CAGAGCCACAAATTGGGAAAGGG - Intergenic
1043200936 8:77368631-77368653 AAAAGCCAAAACTGAGAAATGGG + Intergenic
1044107432 8:88227953-88227975 CAGAACCACAATTTAGGAATTGG + Intronic
1046841797 8:118866848-118866870 AAAAGCCTCAACTCAGAAATGGG - Intergenic
1047022833 8:120794728-120794750 TAGAGCAGCAACTAAGAAATGGG - Intronic
1047283152 8:123463541-123463563 CTGAGTCAAAACTGAGAAATGGG - Intronic
1047664318 8:127073906-127073928 AAGAGGCAGAAATTAGAAATAGG + Intergenic
1048031043 8:130632639-130632661 AAGAGCCACATCTTAGAACTGGG + Intergenic
1048992110 8:139766490-139766512 CAGAGCCACAACTTGCATTTGGG - Intronic
1051701842 9:19832721-19832743 CAAAGCCAAAACTGACAAATGGG + Intergenic
1056140360 9:83672475-83672497 CTGAGACACAACATTGAAATTGG - Intronic
1057327991 9:94083824-94083846 CAGAGGCATAACTAAGAATTGGG + Intronic
1057993473 9:99797595-99797617 CAGATCCAAAACTAGGAAATGGG + Intergenic
1058938885 9:109794831-109794853 CAGAGCCATAATTGTGAAATCGG + Intronic
1059995083 9:119901132-119901154 CAAAGCCAAAACTGACAAATGGG - Intergenic
1203360048 Un_KI270442v1:211891-211913 CAAAGCCACAATTGACAAATGGG + Intergenic
1186860907 X:13671544-13671566 CAGAAGCCCAACTTAAAAATGGG + Intronic
1188730596 X:33641008-33641030 CAAAGCCAAAACTGACAAATGGG + Intergenic
1188769387 X:34132558-34132580 CAGAAACACAATTTAAAAATGGG - Intergenic
1188831602 X:34905006-34905028 CAGAGCAAAAACTTAAAGATGGG + Intergenic
1190218095 X:48493399-48493421 CAGAGGCAAAGCTTGGAAATGGG + Intergenic
1191062481 X:56314392-56314414 GAGAGACACAACATATAAATCGG + Intergenic
1191111682 X:56808210-56808232 CAGAGACACAACAAAGAAAGAGG - Intergenic
1191670046 X:63740614-63740636 CAAAGCCAAAGCTGAGAAATGGG + Intronic
1191732137 X:64348293-64348315 AAGAGCTTCAACTTAGACATTGG - Intronic
1193581471 X:83268884-83268906 CAGAGCAAAAATTTACAAATGGG + Intergenic
1193629203 X:83861014-83861036 CACATCCACAATTTAAAAATAGG + Intergenic
1193797416 X:85892783-85892805 TAGAGCTACTACTTAAAAATGGG - Intronic
1194148862 X:90298339-90298361 CAGAGCTTGAACTTAGTAATGGG + Intergenic
1195561272 X:106287115-106287137 CAAAGCCACTACTTAGGAAAGGG - Intergenic
1195953566 X:110304874-110304896 CAGAGAAACATCTTAGACATAGG - Intronic
1197181355 X:123540273-123540295 CAAAGCCACAAACTAGAAAAAGG + Intergenic
1198691709 X:139292079-139292101 CAGAGCCATGACTCAGAAACTGG + Intergenic
1199011580 X:142764850-142764872 CAAAGCCAAAACTGACAAATGGG - Intergenic
1200495230 Y:3875068-3875090 CAGAGCTTGAACTTAGTAATGGG + Intergenic
1202036919 Y:20645588-20645610 CATAGCCACAACTAACAAGTCGG - Intergenic