ID: 907713337

View in Genome Browser
Species Human (GRCh38)
Location 1:56904792-56904814
Sequence TGCCATCTAAGACCCCAAAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907713337_907713338 16 Left 907713337 1:56904792-56904814 CCTCTTTGGGGTCTTAGATGGCA No data
Right 907713338 1:56904831-56904853 TCATGCTTCTCAAGTCAGACTGG 0: 1
1: 0
2: 0
3: 11
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907713337 Original CRISPR TGCCATCTAAGACCCCAAAG AGG (reversed) Intronic
No off target data available for this crispr