ID: 907714344

View in Genome Browser
Species Human (GRCh38)
Location 1:56913593-56913615
Sequence GCATACTCTTGGGGCTAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907714344_907714350 10 Left 907714344 1:56913593-56913615 CCCTTTTAGCCCCAAGAGTATGC No data
Right 907714350 1:56913626-56913648 TCCTAAGCTCCCACTTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907714344 Original CRISPR GCATACTCTTGGGGCTAAAA GGG (reversed) Intronic