ID: 907714345

View in Genome Browser
Species Human (GRCh38)
Location 1:56913594-56913616
Sequence TGCATACTCTTGGGGCTAAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 102
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907714345_907714354 30 Left 907714345 1:56913594-56913616 CCTTTTAGCCCCAAGAGTATGCA 0: 1
1: 0
2: 0
3: 6
4: 95
Right 907714354 1:56913647-56913669 GGCACATAAAACTGTTTGTATGG No data
907714345_907714350 9 Left 907714345 1:56913594-56913616 CCTTTTAGCCCCAAGAGTATGCA 0: 1
1: 0
2: 0
3: 6
4: 95
Right 907714350 1:56913626-56913648 TCCTAAGCTCCCACTTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907714345 Original CRISPR TGCATACTCTTGGGGCTAAA AGG (reversed) Intronic