ID: 907714346 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:56913602-56913624 |
| Sequence | TTGGAACATGCATACTCTTG GGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 154 | |||
| Summary | {0: 1, 1: 0, 2: 2, 3: 8, 4: 143} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 907714346_907714350 | 1 | Left | 907714346 | 1:56913602-56913624 | CCCCAAGAGTATGCATGTTCCAA | 0: 1 1: 0 2: 2 3: 8 4: 143 |
||
| Right | 907714350 | 1:56913626-56913648 | TCCTAAGCTCCCACTTTTTCAGG | No data | ||||
| 907714346_907714354 | 22 | Left | 907714346 | 1:56913602-56913624 | CCCCAAGAGTATGCATGTTCCAA | 0: 1 1: 0 2: 2 3: 8 4: 143 |
||
| Right | 907714354 | 1:56913647-56913669 | GGCACATAAAACTGTTTGTATGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 907714346 | Original CRISPR | TTGGAACATGCATACTCTTG GGG (reversed) | Intronic | ||