ID: 907714346

View in Genome Browser
Species Human (GRCh38)
Location 1:56913602-56913624
Sequence TTGGAACATGCATACTCTTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 154
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 143}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907714346_907714354 22 Left 907714346 1:56913602-56913624 CCCCAAGAGTATGCATGTTCCAA 0: 1
1: 0
2: 2
3: 8
4: 143
Right 907714354 1:56913647-56913669 GGCACATAAAACTGTTTGTATGG No data
907714346_907714350 1 Left 907714346 1:56913602-56913624 CCCCAAGAGTATGCATGTTCCAA 0: 1
1: 0
2: 2
3: 8
4: 143
Right 907714350 1:56913626-56913648 TCCTAAGCTCCCACTTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907714346 Original CRISPR TTGGAACATGCATACTCTTG GGG (reversed) Intronic