ID: 907714347

View in Genome Browser
Species Human (GRCh38)
Location 1:56913603-56913625
Sequence ATTGGAACATGCATACTCTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907714347_907714354 21 Left 907714347 1:56913603-56913625 CCCAAGAGTATGCATGTTCCAAT No data
Right 907714354 1:56913647-56913669 GGCACATAAAACTGTTTGTATGG No data
907714347_907714350 0 Left 907714347 1:56913603-56913625 CCCAAGAGTATGCATGTTCCAAT No data
Right 907714350 1:56913626-56913648 TCCTAAGCTCCCACTTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907714347 Original CRISPR ATTGGAACATGCATACTCTT GGG (reversed) Intronic