ID: 907714348 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:56913604-56913626 |
| Sequence | AATTGGAACATGCATACTCT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | ||||
| Summary |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 907714348_907714354 | 20 | Left | 907714348 | 1:56913604-56913626 | CCAAGAGTATGCATGTTCCAATT | No data | ||
| Right | 907714354 | 1:56913647-56913669 | GGCACATAAAACTGTTTGTATGG | No data | ||||
| 907714348_907714350 | -1 | Left | 907714348 | 1:56913604-56913626 | CCAAGAGTATGCATGTTCCAATT | No data | ||
| Right | 907714350 | 1:56913626-56913648 | TCCTAAGCTCCCACTTTTTCAGG | No data |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 907714348 | Original CRISPR | AATTGGAACATGCATACTCT TGG (reversed) | Intronic | ||