ID: 907714349

View in Genome Browser
Species Human (GRCh38)
Location 1:56913621-56913643
Sequence AAAAGTGGGAGCTTAGGAAT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 894
Summary {0: 1, 1: 0, 2: 1, 3: 61, 4: 831}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907714349_907714356 30 Left 907714349 1:56913621-56913643 CCAATTCCTAAGCTCCCACTTTT 0: 1
1: 0
2: 1
3: 61
4: 831
Right 907714356 1:56913674-56913696 TAAAATGATGGCAAAATGTATGG No data
907714349_907714354 3 Left 907714349 1:56913621-56913643 CCAATTCCTAAGCTCCCACTTTT 0: 1
1: 0
2: 1
3: 61
4: 831
Right 907714354 1:56913647-56913669 GGCACATAAAACTGTTTGTATGG No data
907714349_907714355 18 Left 907714349 1:56913621-56913643 CCAATTCCTAAGCTCCCACTTTT 0: 1
1: 0
2: 1
3: 61
4: 831
Right 907714355 1:56913662-56913684 TTGTATGGTACATAAAATGATGG 0: 1
1: 0
2: 0
3: 21
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907714349 Original CRISPR AAAAGTGGGAGCTTAGGAAT TGG (reversed) Intronic