ID: 907714349 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 1:56913621-56913643 |
| Sequence | AAAAGTGGGAGCTTAGGAAT TGG (reversed) |
| Strand | - |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 894 | |||
| Summary | {0: 1, 1: 0, 2: 1, 3: 61, 4: 831} |
Found 3 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 907714349_907714356 | 30 | Left | 907714349 | 1:56913621-56913643 | CCAATTCCTAAGCTCCCACTTTT | 0: 1 1: 0 2: 1 3: 61 4: 831 |
||
| Right | 907714356 | 1:56913674-56913696 | TAAAATGATGGCAAAATGTATGG | No data | ||||
| 907714349_907714354 | 3 | Left | 907714349 | 1:56913621-56913643 | CCAATTCCTAAGCTCCCACTTTT | 0: 1 1: 0 2: 1 3: 61 4: 831 |
||
| Right | 907714354 | 1:56913647-56913669 | GGCACATAAAACTGTTTGTATGG | No data | ||||
| 907714349_907714355 | 18 | Left | 907714349 | 1:56913621-56913643 | CCAATTCCTAAGCTCCCACTTTT | 0: 1 1: 0 2: 1 3: 61 4: 831 |
||
| Right | 907714355 | 1:56913662-56913684 | TTGTATGGTACATAAAATGATGG | 0: 1 1: 0 2: 0 3: 21 4: 284 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 907714349 | Original CRISPR | AAAAGTGGGAGCTTAGGAAT TGG (reversed) | Intronic | ||