ID: 907714350

View in Genome Browser
Species Human (GRCh38)
Location 1:56913626-56913648
Sequence TCCTAAGCTCCCACTTTTTC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907714348_907714350 -1 Left 907714348 1:56913604-56913626 CCAAGAGTATGCATGTTCCAATT No data
Right 907714350 1:56913626-56913648 TCCTAAGCTCCCACTTTTTCAGG No data
907714347_907714350 0 Left 907714347 1:56913603-56913625 CCCAAGAGTATGCATGTTCCAAT No data
Right 907714350 1:56913626-56913648 TCCTAAGCTCCCACTTTTTCAGG No data
907714345_907714350 9 Left 907714345 1:56913594-56913616 CCTTTTAGCCCCAAGAGTATGCA 0: 1
1: 0
2: 0
3: 6
4: 95
Right 907714350 1:56913626-56913648 TCCTAAGCTCCCACTTTTTCAGG No data
907714346_907714350 1 Left 907714346 1:56913602-56913624 CCCCAAGAGTATGCATGTTCCAA 0: 1
1: 0
2: 2
3: 8
4: 143
Right 907714350 1:56913626-56913648 TCCTAAGCTCCCACTTTTTCAGG No data
907714344_907714350 10 Left 907714344 1:56913593-56913615 CCCTTTTAGCCCCAAGAGTATGC No data
Right 907714350 1:56913626-56913648 TCCTAAGCTCCCACTTTTTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907714350 Original CRISPR TCCTAAGCTCCCACTTTTTC AGG Intronic