ID: 907714351

View in Genome Browser
Species Human (GRCh38)
Location 1:56913627-56913649
Sequence GCCTGAAAAAGTGGGAGCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907714351_907714354 -3 Left 907714351 1:56913627-56913649 CCTAAGCTCCCACTTTTTCAGGC No data
Right 907714354 1:56913647-56913669 GGCACATAAAACTGTTTGTATGG No data
907714351_907714356 24 Left 907714351 1:56913627-56913649 CCTAAGCTCCCACTTTTTCAGGC No data
Right 907714356 1:56913674-56913696 TAAAATGATGGCAAAATGTATGG No data
907714351_907714355 12 Left 907714351 1:56913627-56913649 CCTAAGCTCCCACTTTTTCAGGC No data
Right 907714355 1:56913662-56913684 TTGTATGGTACATAAAATGATGG 0: 1
1: 0
2: 0
3: 21
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907714351 Original CRISPR GCCTGAAAAAGTGGGAGCTT AGG (reversed) Intronic