ID: 907714352

View in Genome Browser
Species Human (GRCh38)
Location 1:56913635-56913657
Sequence TTTTATGTGCCTGAAAAAGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 330
Summary {0: 1, 1: 0, 2: 1, 3: 38, 4: 290}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907714352_907714355 4 Left 907714352 1:56913635-56913657 CCCACTTTTTCAGGCACATAAAA 0: 1
1: 0
2: 1
3: 38
4: 290
Right 907714355 1:56913662-56913684 TTGTATGGTACATAAAATGATGG 0: 1
1: 0
2: 0
3: 21
4: 284
907714352_907714356 16 Left 907714352 1:56913635-56913657 CCCACTTTTTCAGGCACATAAAA 0: 1
1: 0
2: 1
3: 38
4: 290
Right 907714356 1:56913674-56913696 TAAAATGATGGCAAAATGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907714352 Original CRISPR TTTTATGTGCCTGAAAAAGT GGG (reversed) Intronic