ID: 907714353

View in Genome Browser
Species Human (GRCh38)
Location 1:56913636-56913658
Sequence GTTTTATGTGCCTGAAAAAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 264
Summary {0: 1, 1: 0, 2: 2, 3: 24, 4: 237}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907714353_907714355 3 Left 907714353 1:56913636-56913658 CCACTTTTTCAGGCACATAAAAC 0: 1
1: 0
2: 2
3: 24
4: 237
Right 907714355 1:56913662-56913684 TTGTATGGTACATAAAATGATGG 0: 1
1: 0
2: 0
3: 21
4: 284
907714353_907714356 15 Left 907714353 1:56913636-56913658 CCACTTTTTCAGGCACATAAAAC 0: 1
1: 0
2: 2
3: 24
4: 237
Right 907714356 1:56913674-56913696 TAAAATGATGGCAAAATGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907714353 Original CRISPR GTTTTATGTGCCTGAAAAAG TGG (reversed) Intronic