ID: 907714354

View in Genome Browser
Species Human (GRCh38)
Location 1:56913647-56913669
Sequence GGCACATAAAACTGTTTGTA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
907714351_907714354 -3 Left 907714351 1:56913627-56913649 CCTAAGCTCCCACTTTTTCAGGC No data
Right 907714354 1:56913647-56913669 GGCACATAAAACTGTTTGTATGG No data
907714347_907714354 21 Left 907714347 1:56913603-56913625 CCCAAGAGTATGCATGTTCCAAT No data
Right 907714354 1:56913647-56913669 GGCACATAAAACTGTTTGTATGG No data
907714345_907714354 30 Left 907714345 1:56913594-56913616 CCTTTTAGCCCCAAGAGTATGCA 0: 1
1: 0
2: 0
3: 6
4: 95
Right 907714354 1:56913647-56913669 GGCACATAAAACTGTTTGTATGG No data
907714349_907714354 3 Left 907714349 1:56913621-56913643 CCAATTCCTAAGCTCCCACTTTT 0: 1
1: 0
2: 1
3: 61
4: 831
Right 907714354 1:56913647-56913669 GGCACATAAAACTGTTTGTATGG No data
907714346_907714354 22 Left 907714346 1:56913602-56913624 CCCCAAGAGTATGCATGTTCCAA 0: 1
1: 0
2: 2
3: 8
4: 143
Right 907714354 1:56913647-56913669 GGCACATAAAACTGTTTGTATGG No data
907714348_907714354 20 Left 907714348 1:56913604-56913626 CCAAGAGTATGCATGTTCCAATT No data
Right 907714354 1:56913647-56913669 GGCACATAAAACTGTTTGTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
907714354 Original CRISPR GGCACATAAAACTGTTTGTA TGG Intronic